Premix taq

For confirmation, primers were designed to amplify the CDS sequence of netB gene. The primer sequence was NetB F: 5′- TTGAAAAGATTAAAAATTAT-3′ and NetB R: 5′- GTAAGAAATCAAATCATATTG-3′. The netB gene was amplified using T100 thermocycler (Bio-Rad Laboratories, Inc., Hercules, CA, USA) in a reaction containing positive PCR product (1 µL), Premix Taq (LA Taq Version 2.0) 12.5 µL, primers (forward 0.5 µL), (reverse 0.5 µL), ddH2O (10.5 µL). The reaction conditions were 94 °C for 2 min, followed by 35 cycles of 98 °C for 10 sec, 47 °C for 30 s, and 68 °C for 1 min and final extension 72 °C for 10 min. The amplified product was electrophoresed on 2% agarose gel and observed under UV trans-illuminator. The purification of PCR product was performed through Gene Jet purification kit (OMEGA). After purification, Ligation was performed with T4 DNA Ligase, and recombinant plasmid (pMD18-T vector (Takara) containing netB gene sequence) was inserted into E. coli DH5α competent cells (Transgen Biotech, Beijing, China). Ligation was performed at 4 °C for overnight incubation. Transformation was confirmed by performing colony PCR of 4 single colonies by mixing with 10 µL ddH2O as a template. The cloned bacteria identified as positive by PCR were sent to Sangon Bioengineering (Shanghai) Co., Ltd. for sequencing.

Total RNA was extracted from harvested astrocytes (n = 6) by using RANiso plus (#9108, TaKaRa, Beijing, China) [54 (link)] and the concentration of RNA was measured by spectrophotometer. A total of 1 µg of RNA was reverse transcribed to generate cDNA using the PrimeScript™ II 1st Strand cDNA Synthesis Kit (TaKaRa, Beijing, China). Messenger expression of TBCB as a housekeeping gene was assessed by real-time PCR. PCR amplification was performed using a T100 thermal cycler (BIO-RAD) and Premix Taq™ (TaKaRa, Beijing, China). The PCR mixture consisted of 1 μL of each primer, 25 μL of Premix Taq, and 1 μL of cDNA in a final volume of 50 μL. The PCR conditions were denaturation at 94 °C for 3 min, followed by 34 cycles of denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, and extension at 72 °C for 30 s. All qPCRs were run on a CFX96 real-time system (Bio-Rad). The 2^−ΔΔCt method was used to calculate the RNA or miRNA level fold change compared to the control samples [52 (link)]. The primer sequences (5′- > 3′) were as follows: TBCB, forward ATGGAGCAGACGACAAGTTCT, reverse CCGTCATCCACAGGATAGGAG, product size (77 bp); β-actin (control), forward CAGCCTTCCTTCTTGGGTA, reverse TTTACGGATGTCAACGTCACAC, product size (87 bp). All operations were carried out in strict accordance with the manufacturer’s instructions.