Lyophilized berries were first ground using a micropestle (Sigma-Aldrich, catalog no. 3 Z359947) in a 1.5-ml Eppendorf microcentrifuge tube. DNA extractions were performed using a modification of the Qiagen DNeasy Plant Mini Kit (Qiagen, Germany, catalog no. 69104). Samples were subjected to two centrifugations (2 min, 20,000g) through the QIAshredder Mini column. The Internal Transcribed Spacer 1 and 2 + 5.8S ribosomal RNA (rRNA) gene (ITS rDNA) was amplified using the primers ITS5 and ITS4 (36 ) using iProof High-Fidelity Master Mix (Bio-Rad, catalog no. 172-5310). Polymerase chain reaction (PCR) products were purified using Qiagen’s PCR Gel Extraction Kit (catalog no. 28704) from a 2% agarose gel. PCR products were sequenced (Genewiz) using ITS 2, 3, 4, and 5 primers (36 ).
Iproof high fidelity master mix
Manufactured by Bio-Rad
Sourced in United States
The IProof High-Fidelity Master Mix is a reagent designed for high-fidelity DNA amplification. It contains a high-fidelity DNA polymerase, buffer, and dNTPs necessary for accurate DNA replication.
Automatically generated - may contain errors
Lab products found in correlation
Pcr gel extraction kit, by Qiagen (1 mentions)
Dneasy plant mini kit, by Qiagen (1 mentions)
Agencourt ampure xp bead, by Beckman Coulter (1 mentions)
Nextseq 500, by Illumina (1 mentions)
Dna quickextract, by Illumina (1 mentions)
Quickextract, by Illumina (1 mentions)
Zero blunt topo pcr cloning kit, by Thermo Fisher Scientific (1 mentions)
Megascript t7 kit, by Thermo Fisher Scientific (1 mentions)
Turbo dna free kit, by Thermo Fisher Scientific (1 mentions)
Superscript 3, by Thermo Fisher Scientific (1 mentions)
Genelute hp plasmid miniprep kit, by Merck Group (1 mentions)
Sybr safe dna gel stain, by Thermo Fisher Scientific (1 mentions)
Ecori, by New England Biolabs (1 mentions)
Pgem t easy, by Promega (1 mentions)
6 protocols using iproof high fidelity master mix
1
DNA Extraction and ITS Sequencing of Berries
2
Detecting P. falciparum Malaria via PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Five μl of DNA samples were used to detect the P. falciparum malaria parasite using a polymerase chain reaction (PCR), targeting for msp2 (FC27) clone as described in details below. Nested PCR was performed to determine the numbers of msp2 (FC27) clone. Amplifications were done in 10 μl reaction mixture containing DNA template, iProof™ High-Fidelity Master Mix (BIO-RAD Laboratories, Hercules, CA) and 500 nM of primer pairs. The methodology and sequences of used primers have been presented in detail elsewhere in
[24 (link)] and
[25 (link)], respectively. For the negative controls, blood samples were collected from Swedish individuals who were never exposed to P. falciparum malaria parasites. For the positive controls, blood samples were collected from Sudanese individuals who have been exposed to P. falciparum malaria parasites in the past.
[24 (link)] and
[25 (link)], respectively. For the negative controls, blood samples were collected from Swedish individuals who were never exposed to P. falciparum malaria parasites. For the positive controls, blood samples were collected from Sudanese individuals who have been exposed to P. falciparum malaria parasites in the past.
3
Single-Molecule Molecular Inversion Probe for Mutational Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The single-molecule molecular inversion probe (smMIP) procedure was performed as described elsewhere [22 (link)]. In short, a pool of smMIPs covering 41 mutational hotspot regions of 23 distinct genes, including GNAS, was phopshorylated with T4 polynucleotide kinase. A total of 100 ng genomic DNA was used as input in the capture reaction with the diluted phosphorylated smMIP pool. After extension, ligation and exonuclease treatment, PCR reactions were performed with barcoded reverse primers and iProof high-fidelity master-mix (Biorad). PCR reactions of the different samples were pooled, and purified with 0.8 x volume of Agencourt Ampure XP Beads (Beckman Coulter, Brea, CA). The purified libraries were prepared for sequencing on a NextSeq 500 instrument (Illumina, San Diego, CA) according to the manufacturer’s protocol (300 cycles Mid Output sequencing kit, v2), resulting in 2 × 150 bp paired-end reads. Data analyses were performed as previously described [22 (link)]. Variants were called at a VAF of > 1% and ≥ 3 mutant gDNA molecules and a minimum of 20 gDNA molecules analyzed at that position. Samples that did not fulfil the standard settings with respect to gene coverage in combination with tumor load were marked as inconclusive [22 (link)].
4
CCR5 Genetic Modification Protocol
5
Molecular Cloning and dsRNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNA was amplified using the total RNA of ISE6 cells as a template. Contaminating genomic DNA was removed by treating total RNA samples with the Turbo DNA-free kit (Ambion) and cDNA was synthesized using Superscript III (Invitrogen) according to the manufactures’ instructions. The cDNA encoding Ago-16, Ago-30, RdRP1 and RdRP3 were amplified using primers listed in S5 Table , and clones were obtained by inserting the amplified cDNAs in the NotI-XbaI sites of pEGFP with a modified multiple-cloning-site sequence [76 (link)]. The sequences of the inserts were verified by sequencing.
For the preparation of templates for dsRNA synthesis, ~500bp fragments of sRNA factors were amplified from cDNA of ISE6 cells using primers listed inS1 Table using iProof High-Fidelity Master Mix (Bio-Rad) and the amplicons were treated with XhoI to insert them in the XhoI site of pLitmus28i (NEB). To obtain templates for in vitro transcription, LitmusA and LitmusB primers were used (S5 Table ). 5ul of the PCR product was used in a 20ul in vitro transcription reaction using Megascript T7 kit (Ambion). dsRNA was purified by Phenol/Chloroform extraction followed by ethanol precipitation as described previously [76 (link)].
For the preparation of templates for dsRNA synthesis, ~500bp fragments of sRNA factors were amplified from cDNA of ISE6 cells using primers listed in
6
Amplification and Cloning of ToxA Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ToxA gene was amplified from genomic DNA using primer pair ToxAscreeningF 5’ CCTCGTACTTCTTTTCAGCG 3’ and ToxAscreeningR1 5’ TGTAGAAGACAAGATTTTGA 3’ . PCR products were visualized by gel electrophoresis on 1.5% agarose gel and stained using SYBR safe DNA Gel stain (Life Technologies, Carlsbad, CA, USA). The 1630 bp region containing the ORF of the ToxA gene was amplified with ToxA1630F 5’ ACCATAGGCGACCGAGTAGA 3’ and ToxA1630R 5’ GATGGCGCCCGTGATAAATG 3’ using iProof High-Fidelity Master Mix (Bio-Rad, Hercules, CA, USA) as described in Moffat et al., 2014 [15 (link)]. The PCR product was gel-extracted and cloned into pGEM-T Easy (Promega). Plasmids were recovered from E. coli cultures using the GenEluteTM HP plasmid Miniprep Kit (Sigma) and digested with EcoRI (NEB) to confirm the PCR insert size. Sequencing reactions were performed as described in Moffat et al., 2015 [30 (link)]. The Australian Genome Research Facility (AGRF) sequenced the entire plasmids via Illumina Mi-Seq.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!