The PCa cell lines (LNCaP, 22Rv1, DU145 and PC3) were purchased from Shanghai Cell Bank and cultured in DMEM supplemented with 10% FBS in a humidified atmosphere with 5% CO2 at 37°C. The stable cell lines shRPL22L1‐PC3 and overexpressed RPL22L1‐LNCaP were obtained by transfection of RPL22L1 shRNA lentiviral particles and RPL22L1 lentiviral activation particles, respectively.
Du145
Manufactured by Shanghai Cell Bank
Sourced in China
DU145 is a cell line that originated from a human prostate cancer. It is commonly used in research and scientific studies to investigate various aspects of prostate cancer.
Automatically generated - may contain errors
Lab products found in correlation
Lncap, by Shanghai Cell Bank (9 mentions)
Rwpe 1, by Shanghai Cell Bank (5 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (5 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (3 mentions)
Mcf 7, by Shanghai Cell Bank (2 mentions)
Rpmi 1640, by Thermo Fisher Scientific (2 mentions)
Rpmi 1640 medium, by Thermo Fisher Scientific (2 mentions)
Fetal bovine serum (fbs), by GE Healthcare (1 mentions)
Streptomycin, by Keygen Biotech (1 mentions)
Penicillin, by Keygen Biotech (1 mentions)
Penicillin, by Thermo Fisher Scientific (1 mentions)
Xav939, by Selleck Chemicals (1 mentions)
293t cell line, by Shanghai Cell Bank (1 mentions)
Mg132, by Selleck Chemicals (1 mentions)
Enoxacin, by Merck Group (1 mentions)
5 5 6 6 tetrachloro 1 1 3 3 tetraethylbenzimidazolylcarbocyanine iodide jc 1, by Thermo Fisher Scientific (1 mentions)
Wpmy 1, by Shanghai Cell Bank (1 mentions)
Taxol, by Merck Group (1 mentions)
3 3 dihexyloxacarbocyanine iodide dioc6, by Merck Group (1 mentions)
Cytochrome c immunoassay kit, by R&D Systems (1 mentions)
18 protocols using du145
1
Culturing and Modulating PCa Cell Lines
2
Prostate Cancer Samples Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Two hundreds and ten paraffin-embedded prostate cancer samples and clinical information from April, 2000 to September, 2013 were obtained from consenting patients in General Hospital of Guangzhou Military Command of People's Liberation Army. The age range was 15 to 83 years. The experimental procedures were approved by the Research Ethics Committee of General Hospital of Guangzhou Military Command of People's Liberation Army.
Human prostate cancer cell line 22RV1, DU145, LNCap and human embryonic kidney cell line 293FT cells were purchased from Shanghai Cell Bank of Chinese Academy of sciences. 22RV1 and LNCap were cultured in RPMI-1640 with 10% fetal calf serum. DU145 and PC3 were cultured in F-12 medium with 10% fetal bovine serum. All cell lines were incubated in a 37°C incubator with 5% CO2.
Human prostate cancer cell line 22RV1, DU145, LNCap and human embryonic kidney cell line 293FT cells were purchased from Shanghai Cell Bank of Chinese Academy of sciences. 22RV1 and LNCap were cultured in RPMI-1640 with 10% fetal calf serum. DU145 and PC3 were cultured in F-12 medium with 10% fetal bovine serum. All cell lines were incubated in a 37°C incubator with 5% CO2.
3
Prostate Cancer Cell Line Cultivation and Patient Tissue Collection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCa cell lines DU145 and PC3 were purchased from the Shanghai Cell Bank, Chinese Academy of Sciences (Shanghai, China), and maintained in Dulbecco's modified Eagle's medium (DMEM) (Gibco, Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS; GE Healthcare Life Sciences, Logan, UT, USA), 100 U/ml penicillin and 100 µg/ml streptomycin (KeyGen Biotech. Co. Ltd., Nanjing, China), in an atmosphere of 5% CO2 and 37°C. PCa and nonmalignant prostate tissues were collected from patients who underwent radical prostatectomy at the Department of Urology of The First Affiliated Hospital of Huzhou Teachers College (Huzhou, China). The use of clinical specimens in the present study was approved by the medical ethics committee of The First Affiliated Hospital of Huzhou Teachers College. Detailed information of each tissue donor is provided in Table I .
4
Investigating UBE2N in Prostate Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human prostatic epithelial cell line (HPEpic) was obtained from XinYu Bio-Technology, Shanghai, China. Four prostate cancer cell lines 22RV1, PC3, LNCaP and DU145, and a 293T cell line were provided by the Shanghai Cell Bank (Shanghai, China). RPMI-1640 and DMEM with a mixture of 10% fetal bovine serum (Gibco, Grand Island, NY, USA), penicillin (100 units/ml) and streptomycin (100 µg/ml) were used for cell culture and the cultural condition was 37 °C and 5% CO2/95% air atmosphere. To investigate the role of UBE2N in process of Axin1 protein synthesis, PC3 cells were treated with 10 µM proteasome inhibitor MG132 (S2619; Selleck). To investigate the role of Wnt/β-catenin in UBE2N-mediated prostate cancer progression, PC3 cells were treated with 10 µM XAV939 (S1180; Selleck).
5
Apoptosis Induction in Cancer Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Normal human prostate/stroma cell line WPMY-1, lung adenocarcinoma cell line A549, pancreatic adenocarcinoma cell line PANC-1, hepatocellular carcinoma cell line HepG2, prostate adenocarcinoma cell line PC-3, prostate carcinoma cell lines DU145, LNCaP and C4-2, glioblastoma cell line U251, squamous cell carcinoma cell line SK-MES-1, breast adenocarcinoma cell line MCF-7, and osteosarcoma cell line MG-63 were purchased from Shanghai Cell Bank (Shanghai, China). Roswell Park Memorial Institute (RPMI) 1640 medium and fetal bovine serum (FBS) were purchased from Gibco (Gaithersburg, USA). 3,3′-dihexyloxacarbocyanine iodide (DiOC6) was purchased from Sigma (St. Louis, MO, USA). Caspase-3/9 colorimetric assay kits and cytochrome-c immunoassay kit were purchased from R&D Systems (Minneapolis, MN, USA). 5,5′,6,6′-tetrachloro-1,1′,3,3′-tetraethylbenzimidazolylcarbocyanine iodide (JC-1) was purchased from Molecular Probes (CA, USA). Annexin V/PI apoptosis assay kit was purchased from GeneCopoeia (Rockville, MD, USA). PCR reagents were purchased from Thermo Fisher (Waltham, MA, USA). Taxol and Enoxacin were purchased from Sigma (St. Louis, MO, USA). All solvents were purchased from Sinopharm Co. Ltd. (Shanghai, China). Enoxacin was dissolved in PBS for in vitro and in vivo experiments.
6
Prostate Cancer Cell Line Maintenance
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
LnCap cell line was obtained from American Type Culture Collection (ATCC), DU-145 and PC-3 cell lines were purchased from Shanghai Cell Bank, Chinese Academy of Sciences. LnCap and DU-145 cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM, HyClone, Beijing, China) supplemented with 10% foetal bovine (HyClone, Gaithersburg, Maryland, USA), 100 U/mL penicillin and 100 μg/mL streptomycin (HyClone, Beijing, China). PC-3 cells were cultured in DMEM/F12 medium (HyClone, Beijing, China) supplemented with 10% foetal bovine (HyClone, Gaithersburg, Maryland, USA), 100 U/mL penicillin and 100 μg/mL streptomycin (HyClone, Beijing, China). Cell cultures were incubated in a humidified atmosphere of 95% air and 5% CO2 at 37°C.
7
Culturing Prostate Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCa cell lines, PC-3 and DU145, and the immortalized human prostate epithelial cell line, RWPE1, were purchased from the Shanghai Cell Bank (Shanghai, China). PC-3 and DU145 were cultured in Roswell Park Memorial Institute (RPMI)-1640 medium supplemented with 10% fetal bovine serum (FBS; BI, Jerusalem, Israel) and RWPE1 cells were cultured in Keratinocyte-SFM (Invitrogen, Carlsbad, CA, USA) supplemented with 0.05 mg/mL bovine pituitary extract and 5 ng/mL epidermal growth factor at 37°C in a humidified 5% CO2 incubator.
8
Cell Culture Conditions for Prostate Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCa cells DU145 and 22Rv1 and prostate epithelial cells (RWPE‐1) were obtained from Shanghai Cell Bank (Shanghai, China). DMEM (HyClone, USA) media supplemented with 10% FBS (Bioindustries, ISR) and 1% penicillin–streptomycin (Invitrogen) was used to culture the cells. Cells were grown in a 5% CO2 atmosphere at 37°C.
9
Transfection of Prostate Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human prostate epithelial cells (RWPE‐1) and PCa cells (DU145, PC‐3 and LNCap; Shanghai Cell Bank) were cultured. In addition, 293T cells were gained from the American Type Culture Collection. PSMC4 short hairpin RNA plasmid (shPSMC4), PSMC4 overexpression plasmid, CBX3 overexpression plasmid, CBX3 short hairpin RNA plasmid (shCBX3) or negative control (Genomeditech) were transfected using FuGene HD transfection reagent (E2311, Promega) per the protocol used in a previous study.14
10
Prostate cancer cell line culture and transfection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
One normal prostate cell line RWPE1 and three human PCa cell lines (LNCAP, DU145, and PC3) were obtained from Shanghai Cell Bank, Chinese Academy of Sciences. These cells were cultured in RPMI 1640 (Hyclone, Beijing, China) supplemented with 50 U/ml penicillin, 50 mg/ml streptomycin (Hyclone, Beijing, China), and 10% fetal bovine serum (Gibco, Gaithersburg, Maryland, USA) at 37°C in an atmosphere of 5% CO2. MiR-455-5p/negative-control mimics (miR-NC) and miR-455-5p inhibitor/inhibitor-NC were purchased from GenePharma (Shanghai, China), and si-CCR5/si-NC were purchased from Santa Cruz Biotechnology (California, USA). The overexpression vector for human CCR5 (pcDNA3.1-CCR5) was purchased from YouBio Technology (Nanjing, China). An empty vector was used as negative control. Transfections with oligonucleotides or plasmid vectors were performed with Lipofec-tamine-2000 (Invitrogen, Carlsbad, New Mexico, USA). The sequences of miR-455-5p and inhibitor oligonucleotides were as follows:
miR-455-5p mimics: 5′–GCAGUCCAUGGGCAUAUACAC–3′,
miR-NC: 5′–UUCUCCGAACGUGUCACGUTT–3′,
miR-455-5p inhibitor: 5′–GUGUAUAUGCCCAUGGACUGC–3′ and
inhibitor-NC: ACGUGACACGUUCGGAGAATT.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!