As three siRNA against SHH and scrambled siRNA were synthesized and were used for PC-3 cell transfection according to the manufacturer's instructions. The total RNA of the cell was extracted from cells using Trizol reagent and then was reverse transcribed into cDNA. The BeyoFast™ SYBR Green qPCR Mix (2X) (Beyotime Biotechnology) was used to evaluate the target gene (the primers of the target gene are in Table 1 ) expression level on the Applied Biosystems 7500 Fast Real-Time PCR System. The PCR data were analyzed by 2−ΔΔCT method. The sequences of all primers used are listed in Table 1 .
Beyofast sybr green qpcr mix 2x
Manufactured by Beyotime
Sourced in China
BeyoFast™ SYBR Green qPCR Mix (2X) is a ready-to-use solution for quantitative real-time PCR (qPCR) analysis. It contains SYBR Green I dye, hot-start DNA polymerase, dNTPs, and necessary buffers and additives optimized for sensitive and specific real-time PCR.
Automatically generated - may contain errors
Lab products found in correlation
7500 fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Real time pcr detection system, by Bio-Rad (1 mentions)
Trizon reagent, by CWBIO (1 mentions)
Hifi mmlv cdna kit, by CWBIO (1 mentions)
Trizol, by Beyotime (1 mentions)
Mtt cell proliferation and cytotoxicity assay kit, by Beyotime (1 mentions)
Fetal bovine serum (fbs), by Beyotime (1 mentions)
Rnaeasy animal rna isolation kit, by Beyotime (1 mentions)
Beyort 3 first strand cdna synthesis kit, by Beyotime (1 mentions)
Beyort 3 cdna synthesis kit, by Beyotime (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Beyort q first strand cdna synthesis kit, by Beyotime (1 mentions)
Lightcycler 96, by Roche (1 mentions)
7 protocols using beyofast sybr green qpcr mix 2x
1
Quantifying SHH Gene Expression
2
RNA Extraction and Real-Time PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RNA extraction and real-time PCR was conducted according to the method described by Nasiri-Ansari et al. [26 (link)]. The total RNA in liver and small intestine was extracted with TRIzon reagent (CW0580, Cwbio, Beijing, China), and its concentration was determined by ultra-low volume spectrometer (BioDrop μLite. Biochrom Ltd. Shanghai, China). The RNA samples were immediately reverse transcribed into cDNA by a HiFi-MMLV cDNA Kit (CW0744, Cwbio, Beijing, China). The quantitative real-time PCR (RT qPCR) was conducted in a Real-Time PCR Detection System (CFX96, Bio-Rad, Hercules, CA, USA). BeyoFast™ SYBR Green qPCR Mix (2X) (D7260-5 mL, Beyotime, Shanghai, China) was used to amplify the target fragment. The primers used in this study and their target genes are listed in Table 1 . The PCR procedure used in this study was as follows: pre denaturation (95 °C) for 2 min, followed by 40 cycles, denaturation (95 °C) 15 s, annealed (55 °C) 15 s and extension (72 °C) 30 s. At the end of the PCR procedure, the melting curve was observed at 65 °C to 95 °C to evaluate the specificity of the product. β-actin gene was used as housekeeping gene. The relative expression level of genes were normalized to that of β-actin and calculated according to the 2−ΔΔCT approach.
3
Cytotoxicity Assay of Anti-Cancer Drugs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PAL was purchased from InvivoChem (catalog number: PD-0332991, Libertyville, USA), PTX was purchased from Beyotime (catalog number: SC0213-10mM, Shanghai, China), and MTX was purchased from Selleck (catalog number: CL-14377, Houston, USA). BeyoRT™ complementary DNA (cDNA) kit was purchased from Beyotime (catalog number: D7166, Shanghai, China). Trizol was purchased from Beyotime (catalog number: R0016, Shanghai, China). U266 and KMS27 cell lines were obtained from the biological materials bank of the Shengjing Hospital of China Medical University. Fetal bovine serum (FBS) was purchased from Beyotime (catalog number: C0225, Shanghai, China). BeyoFast™ SYBR Green qPCR Mix (2X) was purchased from Beyotime (catalog number: D7260-25ml, Shanghai, China). The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) Cell Proliferation and Cytotoxicity Assay Kit (catalog number: C0009S, Shanghai, China), Radioimmunoprecipitation (RIPA) buffer (strong) (catalog number: P0013B, Shanghai, China), and bicinchoninic acid (BCA) assay reagent (catalog number: P0010S, Shanghai, China) were purchased from Beyotime.
4
Quantitative Analysis of NDUFA4L2 and GAPDH
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using RNAeasy™ Animal RNA Isolation Kit (Beyotime Biotechnology) and converted to cDNA using BeyoRT™ III First Strand cDNA Synthesis Kit (Beyotime Biotechnology). qPCR was executed using BeyoFast™ SYBR Green qPCR Mix (2X) (Beyotime Biotechnology) on a QuantStudio apparatus (Applied Biosystems) with the following amplification program: an initial denaturation step 95°C for 2 min, followed by 40 cycles of 15s at 95 °C for denature and 30s at 60°C for annealing/extension. Primers 5′-ATGATCGGCTTAATCTGCCTG-3′ and 5′-TCCGGGTTGTTCTTTCTGTCC-3′ were used for NDUFA4L2, and primers 5′-GGAGCGAGATCCCTCCAAAAT-3′ and 5′-GGCTGTTGTCATACTTCTCATGG -3′ were for GAPDH.
5
Quantifying CCL18 Expression in Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The relative expression of CCL18 mRNA in Um95, M23, M17 and SP6.5 cells was detected by realtime PCR. Whole cell RNA was extracted by Trizol (15,596,018, Life Technologies, USA) method and then RNA transcribed into cDNA using a BeyoRT™ III cDNA Synthesis Kit (Beyotime Biotechnology, Shanghai, China). BeyoFast™ SYBR Green qPCR Mix (2X) (D7260, Beyotime Biotechnology, Shanghai, China) kit were used to performed Real-time PCR assay. The qPCR experimental results were calculated by 2−△△CT method. Primer sequences were shown in Table 1 .
Primer sequences for qPCR
| CCL18 | F: GTTGACTATTCTGAAACCAGCCC |
| R: GTCGCTGATGTATTTCTGGACCC | |
| CXCL8 | F: GAGAGTGATTGAGAGTGGACCAC |
| R: CACAACCCTCTGCACCCAGTTT | |
| GTPBP1 | F: CCTTCATCGACTTGGCTGGTCA |
| R: CCAGGTGTTCTTTGGTCATCCC | |
| JAG2 | F: GCTGCTACGACCTGGTCAATGA |
| R: AGGTGTAGGCATCGCACTGGAA | |
| PRELID1 | F: GGAGGACTCTATTGTGGACCCA |
| R: CAGTCCAGCCACTGTTGTCAGA | |
| PTGER4 | F: TACTCATTGCCACCTCCCTGGT |
| R: GACTTCTCGCTCCAAACTTGGC | |
| GAPDH | F: GTCTCCTCTGACTTCAACAGCG |
| R: ACCACCCTGTTGCTGTAGCCAA |
6
Quantification of OLFM2 in Colon Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In accordance with the manufacturer’s instructions, an Oriscience Prime RNA Extraction Kit (Oriscience, China) was used to obtain total RNA from colon cancer cells and colorectal cancer tissues. The obtained total RNA was reverse transcribed into cDNA using the BeyoRT™ Q First Strand cDNA Synthesis Kit (Beyotime, China) according to the instructions. Finally, qRT-PCR was performed using BeyoFast™ SYBR Green qPCR Mix (2X) (Beyotime, China) on the LightCycler 96 (Roche, Switzerland). The internal reference we use is GAPDH. The target gene RNA was obtained by 2-ΔΔCt algorithm. The primer sequence is GAPDH-F GGAGTCCACTGGCGTCTTCA GAPDH-R GTCATGAGTCCTTCCACACGATACC OLFM2-F TCCTTGAGTTGCGGACGTATC OLFM2-R GCCGGAGAGATTCCTCACC.
7
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After total RNA was extracted and its integrity and purity were detected, reverse transcription-PCR was performed to synthesize the first-strand cDNA. Then, BeyoFast™ SYBR Green qPCR Mix (2X) (Beyotime, Shanghai, China) and was used for qRT-PCR experiments. The amplification system included: 10 uL BeyoFast™ SYBR Green qPCRMix (2X), 1 uL cDNA template, 0.5 uL forward primer (3 uM), 0.5 uL reverse primer (3 uM), and 8ul RNase-free water. The reaction condition was: 95 °C for 2 min; 95 °C for 15 s, 60 °C for 15 s, 40 cycles; 60 to 95 °C melting curve. Using 2−ΔΔct method, the expression of the targeted genes in relative to GADPH was calculated. The primers used in qRT-PCR experiments were listed in Table 1 . Each PCR reaction had three repeats.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!