For total RNA extraction, the upper lobes of the right lung tissues (100 mg) were dissolved in Trizol (1 mL) (Life Technologies, Grand Island, NY, USA). RNA was reverse transcribed by use of Moloney Murine Leukemia Virus Reverse (M-MLV) reverse transcriptase (Fermentas, Glen Burnie, MD, USA). An ABI 7500 real-time thermocycler (Applied Biosystems, Foster City, CA, USA) was used to monitor the amplification reactions in real time. The initial activation was at 95 °C for 10 s, 60 °C for 30 s, and 40 cycles; and 95 °C for 15 s, 60 °C for 1 min, 95 °C for 15 s, and 60 °C for 30 s (ABI, Foster City, CA, USA). Real-time PCR was performed using theLightCycler1.5 (Applied Biosystems, Carlsbad, SC, USA) and the SYBRGreenqRCR Mix (Takara, Otsu, Japan).The mouse SIRT1 and PGC-1α primers used for the PCR were as follows: 5′-TGTGGTGAAGATCTATGGAGGC-3′ (forward) and 5′-TGTACTTGCTGCAGACGTGGTA-3′ (reverse) for SIRT1 and 5′-TATGGAGT GACATAGAGTGT GCT-3′ (forward) and 5′-GTCGCTACACCACTTCAATCC (reverse) for PGC-1α and 5′-CCAAGGCCAACCGCGAGAAGATGAC (forward) and 5′-AGGGTACATGGTGGTGCCGC CAGAC (reverse) for β-action. The values of the target genes were normalized using the value of the housekeeping gene β-action. All samples were run in triplicate and the average values were calculated. Omitting cDNA was used as the negative control.
Abi 7500 real time thermocycler
Manufactured by Thermo Fisher Scientific
Sourced in United States
The ABI 7500 real-time thermocycler is a laboratory instrument designed for real-time PCR (polymerase chain reaction) analysis. It provides precise temperature control and thermal cycling capabilities required for amplifying and quantifying nucleic acid samples.
Automatically generated - may contain errors
Lab products found in correlation
Aceq qpcr sybr green master mix, by Vazyme (3 mentions)
Lightcycler1, by Thermo Fisher Scientific (3 mentions)
Moloney murine leukemia virus reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
M mlv reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Quantitect rt mix, by Qiagen (1 mentions)
Qiaamp viral rna mini kit, by Qiagen (1 mentions)
Viral rna mini kit, by Qiagen (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Sas 9, by SAS Institute (1 mentions)
Kingfisher duo, by Thermo Fisher Scientific (1 mentions)
Optical grade 96 well plates, by Thermo Fisher Scientific (1 mentions)
11 protocols using abi 7500 real time thermocycler
1
Lung Tissue RNA Extraction and qPCR Analysis
2
Quantitative PCR Analysis of Chinchilla Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative real-time reverse transcriptase PCR was performed to determine the relative expression of select chinchilla genes. Custom TaqMan Gene Expression Assays were designed and validated for chinchilla genes of interest. DNA-free RNA was isolated and purified using TRIzol reagent according to manufacturer instructions. cDNA libraries were subsequently generated with the High-Capacity RAN-to-cDNA Kit (Applied Biosystems). Quantitative PCR was carried out with TaqMan Advanced 2x Master Mix on an ABI 7500 real-time thermocycler (Applied Biosystems). Relative expression (transcript) was calculated by the delta-delta-Ct method (Livak and Schmittgen, 2001 (link)). Samples were normalized to 18s rRNA transcript and relative fold change in expression was calculated relative to middle ear mucosa from naïve unchallenged chinchillas. Relative levels of GAPDH and 18s rRNA transcript were assessed to verify RNA/cDNA integrity and similar results were obtained when normalized to 18s or GAPDH.
3
SARS-CoV-2 Detection by Real-Time RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pooled tissue samples from each farm were homogenized in phosphate buffer saline (PBS; pH 7.4) and clarified by centrifugation at 400 × g for 10 min. Viral RNA was extracted using a QIAamp Viral RNA Mini Kit (Qiagen, Valencia, CA, USA), according to the manufacturer’s instructions. Extracted RNA was resuspended in RNase-free water and stored at −80°C until analysis. Real-time RT-PCR was performed according to the WHO manual [32 ]. Briefly, the QuantiTech Probe RT-PCR Kit (Qiagen) was used with 12.5 μl of Master Mix, 1.5 μl each of forward and reverse primers (10 μM), 0.5 μl of probe (5 μM), 0.25 μl of QuantiTect®RT Mix, 3.75 μl of RNAase free water, and 5.0 μl of RNA template in a 25-μl total volume. Using an ABI 7500 real-time thermocycler (Applied Biosystems, Foster City, CA, USA), reverse transcription was carried out for 30 minutes at 50°C, followed by polymerase activation for 15 minutes at 95°C. Denaturation for 15 seconds at 94°C and annealing-extension for 1 minute at 56°C were performed for 45 cycles to obtain cycle threshold (Ct) values.
4
Gene Expression Analysis of Brain and Endothelial Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Homogenates of brain tissues and endothelial cells were used to extract total RNA using the Trizol solution (Life, New York, USA), followed by being transcribed into cDNAs with a Moloney Murine Leukemia Virus Reverse transcriptase (Fermentas, Vancouver, Canada). The ABI 7500 real-time thermocycler (Applied Biosystems, California, USA) was used to perform the PCR reaction and the LightCycler1.5 (Applied Biosystems, California, USA) and the AceQ qPCR SYBR Green Master Mix (Vazyme, Nanjing, China) were used to conduct the real-time PCR. Finally, the 2−ΔΔCt method was utilized to determine the expression level of genes by normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The following primers were used: IL-6, Fwd: 5ʹ- TGCCTTCTTGGGACTGATGC-3ʹ, Rev: 5ʹ-GCAAGTGCATCATCGTTGTTC-3ʹ; TNF-α, Fwd: 5ʹ- GACGTGGAACTGGCAGAAGA-3ʹ, Rev: 5ʹ-GGCTACGGCTTGTCACTCG-3ʹ; DKK3, Fwd: 5ʹ-CTCGGGGGTATTTTGCTGTGT-3ʹ, Rev: 5ʹ-TCCTCCTGAGGGTAGTTGAGA-3ʹ; ZO-1, Fwd: 5ʹ-CCGCTAAGAGCAC AGCAAT-3ʹ, Rev: 5ʹ-CATTGCAACTCGGTCATTTT-3ʹ; GAPDH, Fwd: 5ʹ-TGACCTCAACTACATGGTCTACA-3ʹ, Rev: 5ʹ- CTTCCCATTCTCGGCCTTG-3ʹ.
5
Quantification of Nox-4, SIRT1 and GAPDH in BMDMs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were isolated from BMDMs with the Trizol solution (Life, New York, USA) and further transcribed into cDNA using the Moloney Murine Leukemia Virus Reverse transcriptase (Fermentas, Vancouver, Canada), followed by performing the PCR reaction with the ABI 7500 real-time thermocycler (Applied Biosystems, California, USA) under the following amplification conditions: 95°C for 10 s, 60°C for 30 s, and 40 cycles; and 95°C for 15 s, 60°C for 1 min, 95°C for 15 s, and 60°C for 30 s. Then, the LightCycler1.5 (Applied Biosystems, California, USA) and the AceQ qPCR SYBR Green Master Mix (Vazyme, Nanjing, China) were used to conduct the RT-PCR, followed by determining the expression with the 2−ΔΔCt method after normalization with the expression level of GAPDH [21 (link)]. The following primers were used in this study: Nox-4 (forward: 5′-TGCCTGCTCATTTGGCTGT-3′; reverse: 5′- CCGGCACATAGGTAAAAGGATG −3′); SIRT1 (forward: 5′- TGATTGGCACC GACCTCG −3′; reverse: 5′-CCACAGCGTCATATCATCCAG −3′);GADPH (forward: 5′- TGACCTCAACTACATGGTCTACA −3′; reverse: 5′- CTTCCCATTCTCGGCCT TG −3′).
6
Rubella Virus RNA Detection in Urine
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Viral RNA was extracted from the urine of IgM positive persons using a Viral RNA Mini kit (Qiagen, Valencia, CA), per the manufacturer's instructions. Extracted viral RNA was stored at -70°C until the diagnostic real time RT-PCR was performed.
A real-time (TaqMan®) RT-PCR assay was used for the detection of rubella virus RNA using primers and probe specific to a region in the non-structural protein (NSP) coding region using the ABI 7500 Real-Time Thermocycler (Applied Biosystems, USA). Real time PCR was performed using Superscript III One-Step qRT-PCR (Invitrogen, Carlsbad, CA), to amplify a 154-nucleotide region) using a Rubella virus forward primer (RV98F [5′-GGC AGT TGG GTA AGA GAC CA-3′ ]) and a reverse primer (RV251R [5′-CGT GGA GTG CTG GGT GAT-3′ ]). RNA samples were also tested using RNase P forward primer (HURNASE-P-F): 5’-AGA TTT GGA CCT GCG AGC G-3’ and a reverse primer (HURNASE-P-R): 5’-GAG CGG CTG TCT CCA CAA GT-3’ [15 (link)]. Briefly, after the reverse transcription step for 30 min at 55°C and denaturation of cDNA for 5 min at 95°C, the reaction mixtures were incubated for 35 cycles at 95°C for 30s, 60°C for 30s, and final extension at 72°C for 1 min, followed by 72°C for 5 min.
A real-time (TaqMan®) RT-PCR assay was used for the detection of rubella virus RNA using primers and probe specific to a region in the non-structural protein (NSP) coding region using the ABI 7500 Real-Time Thermocycler (Applied Biosystems, USA). Real time PCR was performed using Superscript III One-Step qRT-PCR (Invitrogen, Carlsbad, CA), to amplify a 154-nucleotide region) using a Rubella virus forward primer (RV98F [
7
Validating RNA-seq Differential Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To verify the expression of DEGs identified by the RNA-seq approach, four DEGs, including HSP70, HSP90B1, bovine lymphocyte antigen (BoLA), and major histocompatibility complex, class II, DRB3 (BoLA-DRB3), were randomly picked for real-time PCR analysis. Moreover, 10 genes involved in lactation were selected for RT-PCR analysis, including CSN1S1, CSN2, CSN3, PRLR, STAT5A, STAT5B, CASTOR1, CASTOR2, mTOR, and JAK2. The PrimeScript™ RT reagent Kit (TaKaRa, Kyoto, Japan) was used to synthesis cDNAs in qRT-PCR from the same RNA extractions used for the RNA-seq. Furthermore, cDNAs were diluted 1:5. Glyceraldehyde-3 phosphate dehydrogenase (GAPDH) was selected as the control gene. qRT-PCRs were carried out in an ABI 7500 real-time thermocycler (Applied Biosystems, Foster City, CA, USA). The primers used are listed in Supplementary Materials Table S1 . The comparative cycle threshold (2−ΔΔCt) method was used to determine the relative gene expression. Data are expressed as mean.±.standard error of the mean and were analyzed using SAS 9.2 software (SAS Institute Inc, Cary, NC, USA).
8
Biomarker Evaluation for Cancer Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Serum levels of CEA and CA 19-9 were determined by fluorescent magnetic particle immunoassay kits (ST AIA-PACK CEA kit and ST AIA-PACK CA199 kit; Tosoh Hi-Tech Inc., Tokyo, Japan) on an AIA-2000 automatic immune analyzer (Tosoh Hi-Tech Inc.). The CEA level > 6 ng/mL and CA 19-9 level > 37 U/mL were considered positive. Peripheral blood mSEPT9 was detected by the probe-based real-time polymerase chain reaction (PCR) method, with the Septin9 Methylation Detection kit (Biochain Beijing Technology Co., Ltd, Beijing, China), according to the kit instructions. Briefly, DNA was extracted from peripheral blood. The methylated DNA was directly extracted by the magnetic bead adsorption, and the nonmethylated DNA was converted by the deamination reaction. The real-time PCR was performed on the ABI7500 real-time thermocycler (Applied Biosystems, Foster City, USA). The reaction conditions were as follows: 94°C for 20 min; 62°C for 5 s, 55.5°C for 35 s, 93°C for 30 s, for totally 45 cycles; followed by 40°C for 5 s. The results were interpreted using the ABI 7500 Fast PCR software (Applied Biosystems). Experiment was performed in triplicates.
9
SARS-CoV-2 Detection Protocol via RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nasal and pharyngeal swabs were taken by healthcare personnel and placed in the same tube containing 2 mm of saline solution. Samples were kept at 2°C–8°C and delivered within 4 hours for SARS-CoV-2 detection to the Clinical Virology Laboratory at the University Hospital, where the samples were immediately processed. Nucleic acid extraction was made using a commercial semiautomated viral RNA extraction kit (King Fisher Duo, Thermo Scientific), according to the manufacturer’s instructions. SARS-CoV-2 was detected by real-time PCR according to the CDC protocol,19 targeting N1, N2 viral genes and human RNAse P in individual wells, using FAM-BHQ-1-labelled probes, on an Abi 7500 real-time thermocycler (Applied Biosystems). Samples were considered positive for SARS-CoV-2 if both N1 and N2 targets were amplified at any CT values less than 40. If only one target was detected, the whole extraction and amplification process was repeated. If the discordance between target amplification persisted, a new sample was collected. Negative samples with no amplification of RNAse P were considered invalid.
Only laboratory-confirmed cases are included herein for the consistency of case definition throughout the 8 months of the epidemic in SAA and for comparison; data from the rest of the country and the world were updated to the same point in time.
Only laboratory-confirmed cases are included herein for the consistency of case definition throughout the 8 months of the epidemic in SAA and for comparison; data from the rest of the country and the world were updated to the same point in time.
10
Quantitative RT-PCR Analysis of Gene Expression
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!