Qrt pcr detection system

Total RNA was isolated from ATC cells using TRIzol Reagent, and 2 μg of each RNA sample was reverse-transcribed using M-MLV Reverse Transcriptase (Invitrogen, USA). Fast SYBR GreenMaster Mix was used to analyse the threshold cycle value of each sample by a qRT-PCR detection system (Bio-Rad, USA). GAPDH was used as an internal control to normalize the expression levels. The following primer pairs were used: LNK, sense, 5′-TGTGAGTTGCACGCCGTAGC-3′, and antisense, 5′-GCACCTCGCGGCAGAAGTAG-3′; 14-3-3ε, sense, 5′-GATTCGGGAATATCGGCAAATGG-3′, and antisense, 5′-GCTGGAATGAGGTGTTTGTCC-3′; and 14-3-3γ, sense, 5′-AGCCACTGTCGAATGAGGAAC-3′, and antisense, 5′-CTGCTCAATGCTACTGATGACC-3′. PCR was performed on a PTC-200 PCR system (Bio-Rad, USA) using the following cyclical procedure: 10 min at 95 °C; followed by 40 cycles of 10 s at 95 °C, 10 s at 55 °C, 20 s at 72 °C; and a final extension at 72 °C for 10 min. The reactions were run in triplicate in three independent experiments.

Reverse transcriptase (RT)-polymerase chain reaction (PCR) and quantitative RT (qRT)-PCR were used to detect the miR-365-3p and mRNA expression. We designed a stem-loop RT primer to specifically hybridizing with miR-365-3p or RNU6B. RNU6B was used for normalization. This assay included a reverse transcription reaction using ReverTra Ace (TOYOBO, Osaka, JAPAN). RT-PCR and qRT-PCR were performed with a 1:10 dilution of cDNA, using KAPA SYBR FAST qPCR Kits (KAPA Biosystems, Wilmington, United States) and a qRT-PCR detection system (Bio-Rad, College Station, Texas, USA). The gene expression level was normalized using actin mRNA. The primers used for mRNA expression are listed in the Additional file 1: Table S2.

After 3 days of the protein or protein nanoparticle treatment (20 µg/ml of control HSA NPs, 5 µg/ml of commercial bFGF, 5 µg/ml of bFGF, and 20 µg/ml of HSA-bFGF NPs, respectively), HDFs were harvested for RT-PCR analysis. Total RNA was obtained from harvested cells by NucleoSpin RNA LL kit (Macherey-Nagel, Germany), and complementary DNA (cDNA) was reversely transcribed from 1 µg RNA by RevertAid Reverse Transcriptase (thermo scientific, USA). THUNDERBIRD™ Next SYBR® qPCR Mix (TOYOBO, JAPAN) and qRT-PCR detection system (Bio-Rad CFX connect) were used for real-time RT-PCR. As a housekeeping gene, human glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a control for normalization. Transcript level was calculated relative to control (HSA NPs-treated) and the relative fold induction was calculated using the 2^−ΔΔCt algorithm. Sequences of the primers used in the real-time PCR analysis were as follows: GAPDH (forward 5’-ACCCACTCCTCCACCTTTGA − 3’; reverse 3’- CTGTTGCTGTAGCCAAATTCGT − 5’), α-SMA (forward 5’- TGGGACAAAAAGACAGCTACG − 3’; reverse 3’- GATGCCATGTTCTATCGGGTA − 5’), TGFβ-1 (forward 5’- AACAATTCCTGGCGATACCTC − 3’; reverse 3’- ACAACTCCGGTGACATCAAAA − 5’), TGFβ-2 (forward 5’- TCAAGAGGGATCTAGGGTGGAA − 3’; reverse 3’- GGCATGCTCCAGCACAGAA − 5’).

CNE-1 and CNE-2 cells were transfected with miR-19b-3p mimic/inhibitor/TNFAIP3-siRNA (RiboBio Guangzhou, China) according to manufacturer’s protocol. To determine the efficiency of miRNA mimic/inhibitor/TNFAIP3-siRNA, the expression of miR-19b-3p/TNFAIP3 was assessed with a qRT-PCR detection system (Bio-Rad, Hercules, CA, USA) and Western blot apparatus.