The largest database of trusted experimental protocols

Shcontrol plko 1puro shc002

Manufactured by Merck Group
Sourced in United States

ShControl; pLKO.1puro; SHC002 are laboratory reagents commonly used in molecular biology and genetic engineering research. ShControl is a non-targeting control plasmid, pLKO.1puro is a lentiviral expression vector, and SHC002 is a non-targeting control shRNA. These products are designed to facilitate various experimental techniques, such as gene knockdown and overexpression studies, without making claims about their specific applications or intended uses.

Automatically generated - may contain errors

2 protocols using shcontrol plko 1puro shc002

1

Silencing SET in HNSCC cell lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
The HNSCC cell lines HN12 (tumorigenic and metastatic), HN13 [42 (link)] and Cal27 (ATCC, Manassas, VA, USA) were cultured in Dulbecco’s modified medium (DMEM, Sigma-Aldrich, Munich, Germany), supplemented with 10% fetal bovine serum (FBS, GIBCO, Carlsbad, CA, USA), antibiotics and antimycotics (Sigma-Aldrich) in a humidified atmosphere of 5% CO2 at 37°C. The MISSION short-hairpin RNA (shRNA) plasmid TCR1 containing DNA against human SET (shSET; TRCN0000063717; NM_003011.1-467s1c1; Sigma-Aldrich) or the shRNA control (shControl; pLKO.1puro; SHC002, shRNA non-mammalian target; Sigma-Aldrich) were transfected into HN12 cells using the Turbofect reagent (Thermo, Chelmsford, Massachusetts, USA). Stable transfectants were selected using puromycin (1 μg/mL). Lentivectors containing the shSET and shControl constructs were added to the HN13 and Cal27 cells for transduction. The transduced cells were selected using puromycin (1 μg/mL). For siRNA expression in the HNSCC cell lines, duplex RNA (siRNA) against SET was purchased from Qiagen; the protocol used for this experiment was previously reported [34 (link)]. The efficacy of SET knockdown was evaluated by Western blotting.
+ Open protocol
+ Expand
2

Generating MDA-MB-231 Cell Line for CNOT2 Depletion

Check if the same lab product or an alternative is used in the 5 most similar protocols
To generate MDA-MB-231 stable cell line for depletion of CNOT2 shRNA (TRCN0000015129CCGGCGGGTTACTAACATTCCTCAACTCGAGTTGAGGAATGTTAGTAACCCGTTTTT), control (shControl; pLKO.1puro; SHC002, Sigma-Aldrich) were transfected into MDA-MD-231 cells using the Lipofetamine reagent (Thermo scientific, USA) according to the manufacturer’s protocol.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!