The total RNA was extracted from the liver tissue using Trizol Reagent (Invitrogen, Carlsbad, CA, USA), and cDNA was synthesized from RNA (1 μg) using the reverse transcription reagent kit (TaKaRa, Dalian, China). Real-time PCR was performed with SYBR Green master mixes (TaKaRa, Dalian, China) using a CFX96 Real-Time PCR system (Bio-Rad, Hercules, CA, USA) with the thermal cycle conditions: 1 cycle at 95 °C for 30 s; 40 cycles at 95 °C for 5 s and at 61 °C for 35 s. The primer sequences are listed in Table 2 , and the mRNA expressions of the target genes were normalized to that of β-actin and calculated using the 2−△△CT method.
Sybr green master mixes
Manufactured by Takara Bio
Sourced in China, Switzerland, Japan
SYBR Green master mixes are reagents used for quantitative real-time PCR (qPCR) experiments. They contain SYBR Green I, a fluorescent dye that binds to double-stranded DNA and emits a signal proportional to the amount of DNA present. These master mixes provide all the necessary components, including DNA polymerase, nucleotides, and buffer, for efficient and accurate qPCR analysis.
Automatically generated - may contain errors
Lab products found in correlation
Lightcycler 480 system, by Roche (5 mentions)
Primescript rt master mix kit, by Takara Bio (5 mentions)
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Trizol, by Takara Bio (2 mentions)
Total rna dna isolation kit, by Tiangen Biotech (2 mentions)
Reverse transcription reagent kit, by Takara Bio (1 mentions)
Cfx96 real time pcr system, by Bio-Rad (1 mentions)
Mouse specific primers, by Sangon (1 mentions)
7900ht fast pcr system, by Thermo Fisher Scientific (1 mentions)
M mlv rt kit, by Promega (1 mentions)
Lightcycler480 system, by Thermo Fisher Scientific (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
One step pcr system, by Thermo Fisher Scientific (1 mentions)
9 protocols using sybr green master mixes
1
Quantitative Gene Expression Analysis
2
Regional Brain Tissue Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Brain tissues of the same region (2.0–4.0mm posterior to the frontal pole) were obtained with coronal cut and were divided into ipsilateral and contralateral hemispheres. Total RNA of ipsilateral and contralateral hemispheres was isolated by using Trizol (Takara), and 1 μg of total RNA was reverse-transcribed to cDNA using PrimeScriptTM RT Master Mix Kit (Takara). RT-qPCR was performed with Roche LightCycler480 System (Roche, Basel, Switzerland) by using SYBR Green master mixes (Takara). Quantification was performed by the delta cycle time method, with mouse β-actin used for normalization. The mouse-specific primers (Sangon Biotech, Shanghai, China) are listed in Table 2 .
3
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fresh tissue and cell cultures were processed for total RNA extraction by using the Trizol reagent (Ambion, Carlsbad, CA). Reverse transcription was performed for complementary DNA by using a commercial kit (Takara Bio, Kyoto, Japan). qRT-PCR was carried out on the 7900HT Fast PCR System (Applied Biosystems, Waltham, MA). SYBR Green Master Mixes (Takara Bio) was used as fluorescent dye. The PCR primers were synthesized by AuGCT DNA-SYN Biotech (Beijing, China), and listed in Supplementary Table 1 . The expression levels (relative values) of the objective genes were calculated using the 2−ΔCt method. Glyceraldehyde 3-phosphate dehydrogenase gene was the control.
4
Quantification of Ku70 Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA extraction was conducted using TRIzol (Invitrogen, Carlsbad, CA, USA) based on manufacturers' specifications. Using the M-MLV RT kit (Promega, Madison, WI, USA), 2 μg RNA was reverse-transcribed into cDNA. The PCR reaction using resultant cDNA was conducted using the following primers: Ku70: 5′-GTGGTCACACACGAGCTTATT-3′ (sense) and 5′-CAAATGTCTGATGTTGGTGAACC-3′ (antisense) and β-actin: 5′-TGGATCAGCAAGCAGGAGTA-3′ (sense) and 5′-TCGGCCACATTGTGAACTTT-3′ (antisense). The thermal cycle for PCR was set as follows: 95°C for 2 min, 30 cycles of 94°C for 30 s, 56°C for 45 s, and 72°C for 45 s, with a final extension at 72°C for 7 min on a Lightcycler 480 system (Applied Biosystems, Foster City, CA, USA) using the SYBR Green Master Mixes (Takara, Japan). The Ku70 expression level was normalized to β-actin followed by the quantification through the 2−ΔΔCt method [15 (link)].
5
Quantifying Brain Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA of brain tissues was isolated by using TRIzol (Takara, Kusatsu, Japan) and then reverse-transcribed to cDNA using the PrimeScript™ RT Master Mix Kit (Takara). RT-PCR was conducted with SYBR Green master mixes (Takara) on a Roche LightCycler 480 System to measure the mRNA levels of Trpm4, interleukin (IL)-1β, tumor necrosis factor-α (TNF-α), inducible nitric oxide synthase (iNOS), transforming growth factor-β (TGF-β), Arg1, IL-10 and glyceraldehyde phosphate dehydrogenase (Gapdh). Relative changes in mRNA expression were normalized to Gapdh [19 ].
6
Quantitative Analysis of mRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mRNA levels of SUR1, TRPM4, Il-1, Il-10, TNFα, and GAPDH were routinely measured by quantitative real-time polymerase chain reaction (qPCR). Briefly, total RNA was isolated using a total RNA/DNA isolation kit (Tiangen, Peking, China) and reverse transcribed to cDNA with PrimeScriptTM RT Master Mix Kit (TAKARA) according to the manufacturer's instructions. qPCR was performed using the SYBR Green master mixes (TAKARA) and Roche LightCycler480 System. Relative changes of mRNA expression were normalized to the level of GAPDH.
The Tested genes and primer sequences were listed as follows:
Abcc8: Forward primer 5′-3’: CATCCGGGTGAGGAGATACG;
Reverse primer 5′-3’: CAGGTTAACGAAGGGCTGCA.
Trpm4: Forward primer 5′-3’: TGATGAGCACACCACGGAGA;
Reverse primer 5′-3’: ATCCGTGCGATCAGACAGC.
Il-1: Forward primer 5′-3’: CCTACTTCAGCATCCTCTACTGG;
Reverse primer 5′-3’: AGGGTTTCTTGAGAAGGGGAC.
Il-10：Forward primer 5′-3’: CCCATTCCTCGTCACGATCTC;
Reverse primer 5′-3’: TCAGACTGGTTTGGGATAGGTTT.
Tnfa: Forward primer 5′-3’: CACTCTGGGTACGTGGGTG;
Reverse primer 5′-3’: CACAGGTGATAATGAGGACAGC.
Ccnd1: Forward primer 5′-3’:GCGTACCCTGACACCAATCTC;
Reverse primer 5′-3’: CTCCTCTTCGCACTTCTGCTC.
Nlrp3: Forward primer 5′-3’: ATTACCCGCCCGAGAAAGG;
Reverse primer 5′-3’: TCGCAGCAAAGATCCACACAG.
Gapdh: Forward primer 5′-3’: AGGTCGGTGTGAACGGATTTG;
Reverse primer 5′-3’: TGTAGACCATGTAGTTGAGGTCA.
The Tested genes and primer sequences were listed as follows:
Abcc8: Forward primer 5′-3’: CATCCGGGTGAGGAGATACG;
Reverse primer 5′-3’: CAGGTTAACGAAGGGCTGCA.
Trpm4: Forward primer 5′-3’: TGATGAGCACACCACGGAGA;
Reverse primer 5′-3’: ATCCGTGCGATCAGACAGC.
Il-1: Forward primer 5′-3’: CCTACTTCAGCATCCTCTACTGG;
Reverse primer 5′-3’: AGGGTTTCTTGAGAAGGGGAC.
Il-10：Forward primer 5′-3’: CCCATTCCTCGTCACGATCTC;
Reverse primer 5′-3’: TCAGACTGGTTTGGGATAGGTTT.
Tnfa: Forward primer 5′-3’: CACTCTGGGTACGTGGGTG;
Reverse primer 5′-3’: CACAGGTGATAATGAGGACAGC.
Ccnd1: Forward primer 5′-3’:GCGTACCCTGACACCAATCTC;
Reverse primer 5′-3’: CTCCTCTTCGCACTTCTGCTC.
Nlrp3: Forward primer 5′-3’: ATTACCCGCCCGAGAAAGG;
Reverse primer 5′-3’: TCGCAGCAAAGATCCACACAG.
Gapdh: Forward primer 5′-3’: AGGTCGGTGTGAACGGATTTG;
Reverse primer 5′-3’: TGTAGACCATGTAGTTGAGGTCA.
7
Quantitative Analysis of Key Molecular Targets
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mRNA levels of SUR1, TRPM4, NLRP3, caspase-1, IL-1β, Kir6.1, Kir6.2, K 2P family, Kv family, and GADPH were routinely measured by quantitative real-time polymerase chain reaction (qRT-PCR) (35) . Brie y, total RNA was isolated using Trizol Reagent (Thermo Fisher Scienti c, MA, USA) and reverse transcribed to cDNA with the PrimeScript TM RT Master Mix Kit (Takara, Dalian, China) according to the manufacturer's instructions. qRT-PCR was performed using the SYBR Green master mixes (Takara) and Roche LightCycler480 System. Relative changes of mRNA expression were normalized to the level of GADPH.
8
Quantitative real-time PCR protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
By using the Trizol reagent (Life Technologies), total RNA was extracted from cell cultures or fresh tissues. Reverse transcription was performed with a commercial cDNA kit (Takara Bio, Dalian, China). SYBR Green Master Mixes (Takara Bio) was used as a fluorescent dye. qRT-PCR was carried our using One-Step PCR System (Applied Biosystems, Waltham, MA). The primer sequences (AuGCT DNA-SYN Biotech, Beijing, China) are listed in Supplementary Table S2 online.
9
Quantitative Analysis of mRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mRNA levels of SUR1, TRPM4, TGFα, and GADPH were routinely measured by quantitative real-time polymerase chain reaction (q-PCR). Brie y, total RNA was isolated using a Total RNA/DNA isolation kit (Tiangen, Peking, China) and reverse transcribed to cDNA with PrimeScriptTM RT Master Mix Kit (TAKARA) according to the manufacturer's instructions. q-PCR was performed using the SYBR Green master mixes (TAKARA) and Roche LightCycler480 System. Relative changes of mRNA expression were normalized to the level of GADPH.
Tested genes and primer sequences were listed as follows:
Abcc8: Forward primer 5'-3': CATCCGGGTGAGGAGATACG;
Reverse primer 5'-3': CAGGTTAACGAAGGGCTGCA.
Trpm4: Forward primer 5'-3': TGATGAGCACACCACGGAGA;
Reverse primer 5'-3': ATCCGTGCGATCAGACAGC.
Tgfα: Forward primer 5'-3': CACTCTGGGTACGTGGGTG;
Reverse primer 5'-3': CACAGGTGATAATGAGGACAGC.
Gapdh: Forward primer 5'-3': AGGTCGGTGTGAACGGATTTG;
Reverse primer 5'-3': TGTAGACCATGTAGTTGAGGTCA.
Tested genes and primer sequences were listed as follows:
Abcc8: Forward primer 5'-3': CATCCGGGTGAGGAGATACG;
Reverse primer 5'-3': CAGGTTAACGAAGGGCTGCA.
Trpm4: Forward primer 5'-3': TGATGAGCACACCACGGAGA;
Reverse primer 5'-3': ATCCGTGCGATCAGACAGC.
Tgfα: Forward primer 5'-3': CACTCTGGGTACGTGGGTG;
Reverse primer 5'-3': CACAGGTGATAATGAGGACAGC.
Gapdh: Forward primer 5'-3': AGGTCGGTGTGAACGGATTTG;
Reverse primer 5'-3': TGTAGACCATGTAGTTGAGGTCA.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!