Log In Sign up
The largest database of trusted experimental protocols

Ptripz

Manufactured by GE Healthcare
Visit Supplier
Sourced in United States

PTRIPZ is a laboratory instrument used for the detection and quantification of nucleic acids. It utilizes a technology called real-time PCR (Polymerase Chain Reaction) to amplify and measure the presence of specific DNA or RNA sequences. The core function of PTRIPZ is to provide accurate and reliable data for nucleic acid analysis in various research and diagnostic applications.

Automatically generated - may contain errors

Lab products found in correlation

Lenticrispr v2, by Addgene (2 mentions) Facsaria sorting, by BD (2 mentions) In fusion hd cloning system, by Takara Bio (1 mentions) Ptre tight, by Takara Bio (1 mentions) On targetplus smartpool, by GE Healthcare (1 mentions) Pcdna3, by Thermo Fisher Scientific (1 mentions) Pegfp c1, by Takara Bio (1 mentions) Pmcherry c1, by Takara Bio (1 mentions) Peyfp n1, by Takara Bio (1 mentions) Pecfp c1, by Takara Bio (1 mentions) Pgex 2t, by GE Healthcare (1 mentions) Quikchange xl site directed mutagenesis kit, by Agilent Technologies (1 mentions)

5 protocols using ptripz

1

Overexpressing PPP2R3B in Melanoma Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
SKMEL2 and SKMEL30 melanoma cell lines carry variants affecting codon 61 of NRAS, and were cultured as per manufacturer’s instructions. Normal PPP2R3B copy number in both cell lines was verified by next-generation sequencing (NGS). Human myc-FLAG tagged PPP2R3B ORF clone from Origene (RC222908) was linearized and the insert DNA amplified using modified primers generating an N-terminal Myc tag. The In-Fusion® HD Cloning system (Takara, 638909) was used to allow directional cloning of the PPP2R3B insert into the AgeI-MluI site of the lentiviral vector pTRIPZ (GE Healthcare) resulting in the final PPP2R3B (tet-ON) construct, without the TurboRFP or shRNAmir-related elements of the parental pTRIPZ plasmid. Transduction of HEK 293T cells with pTRIPZ-PPP2R3B in addition to psPAX2 and pMD2.G lentiviral plasmids using Lipofectamine 2000™ generated lentiviral particles used to infect SKMEL2 or SKMEL30 target cells using polybrene to enhance efficiency. Stable cell lines were selected using puromycin.
Polubothu S., Zecchin D., Al-Olabi L., Lionarons D.A., Harland M., Horswell S., Thomas A.C., Hunt L., Wlodarchak N., Aguilera P., Brand S., Bryant D., Carrera C., Chen H., Elgar G., Harwood C.A., Howell M., Larue L., Loughlin S., MacDonald J., Malvehy J., Barberan S.M., da Silva V.M., Molina M., Morrogh D., Moulding D., Nsengimana J., Pittman A., Puig-Butillé J.A., Parmar K., Sebire N.J., Scherer S., Stadnik P., Stanier P., Tell G., Waelchli R., Zarrei M., Puig S., Bataille V., Xing Y., Healy E., Moore G.E., Di W.L., Newton-Bishop J., Downward J, & Kinsler V.A. (2021). Inherited duplications of PPP2R3B predispose to nevi and melanoma via a C21orf91-driven proliferative phenotype. Genetics in Medicine, 23(9), 1636-1647.
+ Open protocol
+ Expand
2

Inducible Tat Expression in Lentivectors

Check if the same lab product or an alternative is used in the 5 most similar protocols
To establish the doxycycline-inducible expression system, the Tet-inducible Tat-expression cassettes were cloned into the third-generation HIV-1-based lentivector expression vector, pCDH-CMV-MCS-EF1-copGFP (CD511B-1, System Biosciences, California, USA). The reverse tetracycline-controlled transactivator 3 gene (rtTA3) was amplified from pTRIPZ (GE Life Sciences, Chicago, USA) (FP: AGTTATGAATTCATGTCTAGGCTGGACAAGAGC and RP: ATACGAGGATCCTTACCCGGGGAGCATGTCAAGGTC). The second-generation Tet-On promoter or tetracycline response element (TRE), Ptight, was amplified from the commercial vector pTRE-Tight (631059, Clontech, California, USA) (FP: TAGGCGATTAATGAGGCCCTTTCGTCTTCACTC, RP: CCATGGGCTAGCCCGGTCCAGGCGATCTGACGG). The BL43 WT C-Tat (CS) and its SAR variant (CC) Tat were amplified from vectors p214.CS and p214.CC, respectively, generated previously in the laboratory and cloned into the MCS downstream of the TRE promoter using the enzyme sites, BglII and EcoRI for CS-Tat and SalI and BamHI for CC-Tat. The recombinant clones express the WT (CS) and variant (CC) Tat proteins, under the inducible Tet-responsive promoter, TRE.
Menon M., Budhwar R., Shukla R.N., Bankar K., Vasudevan M, & Ranga U. (2020). The Signature Amino Acid Residue Serine 31 of HIV-1C Tat Potentiates an Activated Phenotype in Endothelial Cells. Frontiers in Immunology, 11, 529614.
+ Open protocol
+ Expand
3

CRISPR/Cas9-Mediated Knockout of IMPDH Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
For CRISPR/Cas9-mediated gene knockout, gRNAs were designed by CRISPR design program (http://crispr.mit.edu/) (GTGTCGTCGGGTGTGTAGCG for IMPDH1, ACATCCCGCACGCGATCCTT or GATACCGCAGAAACCATGCC for IMPDH2, TCTTGCTCGAGATGTGATGA for HPRT1). gRNAs were subcloned into lentiCRISPRv2 (Addgene plasmid #52961). U87MG, LN229 and A172 cells were transduced with the lentivirus and selected by puromycin. To avoid compensatory responses, IMPDH KO cells were cultured with 100 μM guanosine. Single clones of IMPDH2 and IMPDH DKO U87MG cells were isolated by FACSAria sorting (BD Biosciences). To establish doxycycline-inducible gene-expressing cells, cDNA fragments of mImpdh1, 2 were subcloned into pTRIPZ (GE Healthcare). Transduced cells were treated with 1 μg/ml doxycycline for the ectopic gene expression.
Kofuji S., Hirayama A., Eberhardt A.O., Kawaguchi R., Sugiura Y., Sampetrean O., Ikeda Y., Warren M., Sakamoto N., Kitahara S., Yoshino H., Yamashita D., Sumita K., Wolfe K., Lange L., Ikeda S., Shimada H., Minami N., Malhotra A., Morioka S., Ban Y., Asano M., Flanary V.L., Ramkissoon A., Chow L.M., Kiyokawa J., Mashimo T., Lucey G., Mareninov S., Ozawa T., Onishi N., Okumura K., Terakawa J., Daikoku T., Wise-Draper T., Majd N., Kofuji K., Sasaki M., Mori M., Kanemura Y., Smith E.P., Anastasiou D., Wakimoto H., Holland E.C., Yong W.H., Horbinski C., Nakano I., DeBerardinis R.J., Bachoo R.M., Mischel P.S., Yasui W., Suematsu M., Saya H., Soga T., Grummt I., Bierhoff H, & Sasaki A.T. (2019). IMP dehydrogenase-2 drives aberrant nucleolar activity and promotes tumorigenesis in glioblastoma. Nature cell biology, 21(8), 1003-1014.
+ Open protocol
+ Expand
4

Plasmid Construction and Knockdown Techniques

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Full-length or partial coding regions of each cDNA were amplified by PCR and cloned in-frame into the indicated vectors, including pEGFP-C1, pmCherry-C1, pEYFP-N1, pECFP-C1 (Takara Bio Inc.), pcDNA5/FRT/TO, pcDNA3.1+ (Invitrogen), pTRIPz (GE Healthcare), pGEX-2T (GE Healthcare), pET-14b (EMD Millipore), and pCGN (Fiordalisi et al., 2001 (link)). Amino acid substitutions were generated by site-directed mutagenesis using the QuikChange XL Site-Directed Mutagenesis kit (Agilent Technologies). All plasmids were verified by bidirectional sequencing.
For siRNA knockdown, cells were transfected with ON-TARGETplus SMARTpools (GE Healthcare) targeting VPS35, PDE6D or nontargeting control using DharmaFECT 1 reagent according to the manufacturer’s instructions. For shRNA knockdown, targeting sequences for VPS35 were inserted into pTRIPz lentiviral vector by PCR, and lentiviral particles were generated with standard protocols (http://tcf.epfl.ch/files/content/sites/tcf/files/shared/LV_production.pdf). pTRIPz-based NRAS-targeting lentivirus vectors (Grabocka et al., 2014 (link)) were provided by D. Bar-Sagi (New York University Langone Medical Center, New York, NY). Stable cells lines were generated by lentiviral infection and selection with puromycin for 5 d. Knockdown was induced by 0.4 µg/ml doxycycline for at least 72 h.
Zhou M., Wiener H., Su W., Zhou Y., Liot C., Ahearn I., Hancock J.F, & Philips M.R. (2016). VPS35 binds farnesylated N-Ras in the cytosol to regulate N-Ras trafficking. The Journal of Cell Biology, 214(4), 445-458.
+ Open protocol
+ Expand
5

CRISPR/Cas9-Mediated Knockout of IMPDH Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
For CRISPR/Cas9-mediated gene knockout, gRNAs were designed by CRISPR design program (http://crispr.mit.edu/) (GTGTCGTCGGGTGTGTAGCG for IMPDH1, ACATCCCGCACGCGATCCTT or GATACCGCAGAAACCATGCC for IMPDH2, TCTTGCTCGAGATGTGATGA for HPRT1). gRNAs were subcloned into lentiCRISPRv2 (Addgene plasmid #52961). U87MG, LN229 and A172 cells were transduced with the lentivirus and selected by puromycin. To avoid compensatory responses, IMPDH KO cells were cultured with 100 μM guanosine. Single clones of IMPDH2 and IMPDH DKO U87MG cells were isolated by FACSAria sorting (BD Biosciences). To establish doxycycline-inducible gene-expressing cells, cDNA fragments of mImpdh1, 2 were subcloned into pTRIPZ (GE Healthcare). Transduced cells were treated with 1 μg/ml doxycycline for the ectopic gene expression.
Kofuji S., Hirayama A., Eberhardt A.O., Kawaguchi R., Sugiura Y., Sampetrean O., Ikeda Y., Warren M., Sakamoto N., Kitahara S., Yoshino H., Yamashita D., Sumita K., Wolfe K., Lange L., Ikeda S., Shimada H., Minami N., Malhotra A., Morioka S., Ban Y., Asano M., Flanary V.L., Ramkissoon A., Chow L.M., Kiyokawa J., Mashimo T., Lucey G., Mareninov S., Ozawa T., Onishi N., Okumura K., Terakawa J., Daikoku T., Wise-Draper T., Majd N., Kofuji K., Sasaki M., Mori M., Kanemura Y., Smith E.P., Anastasiou D., Wakimoto H., Holland E.C., Yong W.H., Horbinski C., Nakano I., DeBerardinis R.J., Bachoo R.M., Mischel P.S., Yasui W., Suematsu M., Saya H., Soga T., Grummt I., Bierhoff H, & Sasaki A.T. (2019). IMP dehydrogenase-2 drives aberrant nucleolar activity and promotes tumorigenesis in glioblastoma. Nature cell biology, 21(8), 1003-1014.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!