Gene expression assays were performed with a direct lysis microplate assay.25 Cells were washed with 0.9% w/v saline before lysis in 5 mM Tris, 75 mM saline, and 0.05% Triton X‐100 for 5 min. RT‐qPCR reactions were performed with MicroAmp 96‐Well Reaction Plates (4366932, Thermo Fisher Scientific). Thermal cycling was performed with a 5 μL template and 5 μL reverse transcriptase TaqPath 1‐Step RT‐qPCR Master Mix (A15300, Thermo Fisher Scientific) at 50°C for 15 min, enzyme activation 2 min, amplification 95°C for 3 s/60°C for 15 s (Applied Biosystems QuantStudio 5). TaqMan predesigned assays (exon junction spanning) were used, including Hs00389217_m1 (S100B), Hs00188193_m1 (SLC1A3), Hs01102423_m1 (SLC1A2), Hs00909233_m1 (GFAP), Hs02596860_s1 (MT‐RNR2), Hs00173304_m1 (PPARGC1A), Hs01009006_m1 (SIRT1), Hs02758991_g1 (GAPDH), and Hs00427620_m1 (TBP) (4,331,182, Thermo Fisher Scientific). For IL6 activation assays, astrocyte cultures were treated with saline or 100 μg/mL polyinosinic:polycytidylic acid (poly(I:C)) overnight. Data were acquired with an Applied Biosystems Scientific QuantStudio 5 and analyzed with Quantstudio v1.5.1.
Taqpath 1 step rt qpcr master mix
Manufactured by Thermo Fisher Scientific
Sourced in United States
The TaqPath 1-Step RT-qPCR Master Mix is a ready-to-use solution for reverse transcription and real-time PCR amplification. It is designed for the detection of RNA targets.
Automatically generated - may contain errors
Lab products found in correlation
7500 fast dx real time pcr instrument, by Thermo Fisher Scientific (8 mentions)
2019 ncov cdc ruo kit, by Integrated DNA Technologies (5 mentions)
Quantstudio 7 flex real time pcr system, by Integrated DNA Technologies (5 mentions)
Qiaamp viral rna mini kit, by Qiagen (4 mentions)
Proteinase k, by Thermo Fisher Scientific (4 mentions)
7500 fast real time pcr system, by Thermo Fisher Scientific (3 mentions)
Quantstudio 3 real time pcr system, by Thermo Fisher Scientific (3 mentions)
Quantstudio 3, by Thermo Fisher Scientific (3 mentions)
Quantstudio 5 real time pcr system, by Thermo Fisher Scientific (3 mentions)
Iowa black quencher, by Integrated DNA Technologies (2 mentions)
Allprep 96 powerfecal dna rna kit, by Qiagen (2 mentions)
Maxwell ht 96 gdna blood isolation system, by Promega (2 mentions)
Mock community positive controls, by Zymo Research (2 mentions)
Cfx opus real time pcr system, by Bio-Rad (2 mentions)
Spriselect magnetic beads, by Beckman Coulter (2 mentions)
Rna grade glycogen, by Thermo Fisher Scientific (2 mentions)
Rna storage solution, by Thermo Fisher Scientific (2 mentions)
Ultrapure guanidine isothiocyanate, by Thermo Fisher Scientific (2 mentions)
Cdc n1 and n2 primer probes 2019 ncov ruo kit, by Integrated DNA Technologies (2 mentions)
Buffer rlt lysis buffer, by Qiagen (2 mentions)
77 protocols using taqpath 1 step rt qpcr master mix
1
Quantitative Gene Expression Profiling in Astrocytes
2
Quantifying SARS-CoV-2 Genome Copy Concentration
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We measured SARS-CoV-2 genome copy concentration for each sample by qPCR using conditions outlined in the CDC 2019-Novel Coronavirus EUA protocol (https://www.fda.gov/media/134922/download ). The nucleocapsid gene was amplified using the CDC N1 primer and probe set as follows: 2019-nCoV_N1 Forward Primer GACCCCAAAATCAGCGAAAT; 2019-nCoV_N1 Reverse Primer TCTGGTTACTGCCAGTTGAATCTG; 2019-nCoV_N1 Probe ACCCCGCATTACGTTTGGTGGACC. Probe sequences were FAM labeled with Iowa Black quencher (Integrated DNA Technologies, Coralville, IA). Reactions were performed using TaqPath 1-step RT-qPCR master mix (Thermofisher, Waltham, MA) with 500 nM of each primer and 250 nM of each probe in a total reaction volume of 20 μl. Cycling conditions were as follows: 2 min at 25 °C, 15 min at 50 °C, 2 min at 95 °C, and 45 cycles of 3 seconds at 95 °C, 30 seconds at 55 °C. Samples were run on an Applied Biosystems 7500 FAST real-time PCR system. Cycle threshold (Ct) was designated uniformly across PCR runs.
Standard curves based on serial dilutions of a plasmid containing the nucleocapsid sequence were used to determine copy number for each plate of samples. Copy number is expressed in genome copies per microliter of extracted viral RNA.
Standard curves based on serial dilutions of a plasmid containing the nucleocapsid sequence were used to determine copy number for each plate of samples. Copy number is expressed in genome copies per microliter of extracted viral RNA.
3
SARS-CoV-2 Viral Load Quantification via RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Stool samples, reagent-only negative controls, and mock community positive controls (Zymo Research) were extracted using either the AllPrep PowerFecal DNA/RNA 96 Kit (Qiagen) or the Maxwell HT 96 gDNA Blood Isolation System (Promega) [27 (link)]. SARS-CoV-2 viral load was quantified as per CDC guidelines [28 ] using the 2019-nCoV N1 primer and probe set [28 ], as well as human RNaseP as an internal control. Each RT-qPCR reaction contained TaqPath™ 1-Step RT-qPCR Master Mix (Thermo Fisher), RNA template, the CDC N1 or RNaseP forward and reverse primers (IDT), probe, and RNase-free water to a total reaction volume of 10 μl. Viral copy numbers were quantified using N1 quantitative PCR (qPCR) standards (IDT) in tenfold dilutions to generate a standard curve. The assay was run in triplicate for each sample with three no-template control wells per 384 well plate.
4
SARS-CoV-2 Variant Detection by RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Briefly, RNA was extracted from samples using standard techniques; 10 µl of RNA (1 pg–100 ng) was used in a total reaction volume of 20 µl, using the one-step cDNA and PCR protocol (TaqPath 1-step RT-qPCR MasterMix, Thermo Fisher Scientific) and 501Y.V2 forward and reverse primers (fwd: GATCTCTGCTTTACTAATGTCTATGCAGAT, rev: GCTGGTGCATGTAGAAGTTCAAAAG). PCR reactions underwent thermocycling at the following conditions: Uracil-N-glycosylase (UNG) incubation at 25 °C for 2 min, reverse transcriptase (RT) incubation at 50 °C for 15 min and enzyme activation at 95 °C for 2 min, followed by 40 cycles of amplification at 95 °C for 3 s and 60 °C for 30 s.
5
SARS-CoV-2 RNA Extraction and Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extraction was performed from nasopharyngeal swabs using a standard volume of 200 ul by MagMAX™ Viral/Pathogen Nucleic Acid Isolation Kit (Thermo Fisher, Waltham, MA, USA) and (Applied Biosystem, Waltham, MA, USA). The extracted RNA was stored at −80 °C for downstream application. The real-time quantification and copy number determination of nucleic acid was performed using TaqPath™ 1-Step RT-qPCR Master Mix (Thermo Fisher, Waltham, MA, USA) and the relevant copy number was determined according to the CT and control reactions in quantification. Only samples with relevant CT of 18–28 values were chosen. Using a minimum input amount of 10 ng/uL of the RNA sample, RNA to cDNA reversed transcription was performed with the SuperScript™ VILO™ cDNA Synthesis Kit (Thermo Fisher, Waltham, MA, USA).
6
Paracrine Function of NIH3T3 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We tested the paracrine function of NIH3T3 cells in different groups using RT‒PCR and ELISA (each n = 8, repeated three times). To quantify the vascular endothelial growth factor (VEGF), transforming growth factor-β (TGF-β), and epidermal growth factor (EGF) gene expression in in-vitro culture at 3 d, mRNA from NIH3T3 cells of different samples was extracted and reverse-transcribed to cDNA using TaqPath™ 1-Step RT‒qPCR Master Mix (Thermo Scientific™. USA). RT-PCRs were conducted by CFX Opus Real-Time PCR Systems (Bio-Rad, California, USA). The primers for VEGF, TGF-β, and EGF are presented in the supporting information.
The conditioned culture supernatants of different samples were collected at 1 d, 3 d, 5 d, and 7 d. VEGF, TGF-β, and EGF of the different samples were tested with commercial kits (R&D Systems, USA) according to the manufacturer’s instructions (each n = 8, repeated three times).
The conditioned culture supernatants of different samples were collected at 1 d, 3 d, 5 d, and 7 d. VEGF, TGF-β, and EGF of the different samples were tested with commercial kits (R&D Systems, USA) according to the manufacturer’s instructions (each n = 8, repeated three times).
7
Molecular Analysis of Wound Healing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The wound tissues were harvested at 7 d (each n = 8). The tissues were minced into small rectangular pieces, and soaked in Buffer RLT (Qiagen, Guangzhou, China). mRNA was extracted using RNeasy Mini Kit (Qiagen, Guangzhou, China) according to the manufacturer’s instructions. Subsequently, ∼1 µg total RNA was reverse-transcribed to cDNA using TaqPath™ 1-Step RT‒qPCR Master Mix (Thermo Scientific™. USA). RT-PCRs were conducted by CFX Opus Real-Time PCR Systems (Bio-Rad, California, USA). The primers for VEGF, TGF-β, and EGF are presented in the supporting information.
8
SARS-CoV-2 Detection via Optimized RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Patient samples were determined to be SARS-CoV-2 positive or negative TaqPath™ COVID-19 Combo Kit RT-qPCR assay as described in (https://www.fda.gov/media/136112/download ), and reducing the RT-qPCR reaction volumes to 3μl and diluting the MS2 phage control to improve the limit of detection of the assay. The presence of SARS-CoV-2 viral RNA was analyzed using primers targeting the N, S, and Orf1ab genes with an MS2 control. All RT-qPCR assays were run using TaqPath™ 1-Step RT-qPCR Master Mix (ThermoFisher #A15299) and thermocycling conditions were run following the CDC recommended protocol (https://www.fda.gov/media/136112/download ). Fluorescence data were acquired on a QuantStudio 5 qPCR machine (Applied Biosystems).
9
SARS-CoV-2 Detection by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The presence of human internal control gene RNAse P and SARS-CoV-2 RNA (N1 N2 and N3) in the samples was evaluated through quantitative reverse transcription-polymerase chain reaction (qRT-PCR), as described in CDC 2019-nCoV Real-Time RT-PCR Diagnostic Panel [7 ]. RNA was isolated and purified from 400 uL of nasal fluid specimens using MagCore Viral Nucleic Acid Extraction Kit (RBC Bioscience, Taiwan) according to manufacturer’s instructions. RNA is reverse transcribed to cDNA and subsequently amplified in the Applied Biosystems 7500 Fast Real-Time PCR Instrument using TaqPath™ 1-Step RT-qPCR Master Mix (Thermo Fisher scientific, USA) and N1, N2 and N3 primer and probe set [7 ]. Fluorescence intensity is monitored at each PCR cycle by Applied Biosystems 7500 Fast Real-Time PCR System with SDS version 1.4 software. The cycle threshold (CT) values of qRT-PCR are inversely related to the copy number of human or viral RNA.
The cycle threshold values of RT-PCR were used as indicators of the copy number of SARS-CoV-2 RNA. A cycle threshold value less than 40 is interpreted as positive for SARS-CoV-2 RNA and gene RNase P. If no increase in fluorescent signal is observed after 40 cycles, the sample is assumed to be negative.
The cycle threshold values of RT-PCR were used as indicators of the copy number of SARS-CoV-2 RNA. A cycle threshold value less than 40 is interpreted as positive for SARS-CoV-2 RNA and gene RNase P. If no increase in fluorescent signal is observed after 40 cycles, the sample is assumed to be negative.
10
SARS-CoV-2 Detection by RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RT-qPCR was performed using CDC primers (N1 and N2) and probes from the 2019-nCoV RUO Kit (IDT# 10006713). SARS-CoV-2 RNA was quantified using one-step RT-qPCR in ABI 7500 Fast Real-Time PCR System according to CDC protocol (https://www.fda.gov/media/ 134922/download). In brief, 20 μL reactions included 8.5 μL of Nuclease-free Water, 1.5 μL of Primer and Probe mix (IDT, 10006713), 5 μL of TaqPath 1-Step RT-qPCR Master Mix (ThermoFisher, A15299) and 5 μL of the template. Nuclease-free water was used as negative template control (NTC). Amplification was performed using following program: 25C for 2 min, 50C for 15 min, 95C for 2 min followed by 45 cycles of 95C for 3 s and 55C for 30 s. Run data was analyzed in SDS software v1.4 (Applied Biosystems). The NTC showed no amplification throughout the 40 cycles of qPCR.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!