Sybr green mix

RNA for quantitative PCR analysis was obtained from 30-day-old plants. The full rosette was harvested by grinding in liquid nitrogen, and RNA was obtained using the Qiagen RNeasy Plant kit from approximately 100 mg tissue (fresh weight). One μg total RNA was used in 20 μL reverse transcriptase reactions (Roche) using manufacturer’s instructions and a poly dT₁₈V anchored primer at 48°C. cDNA synthesis reactions were halted after one hour by heating at 70°C and then diluted 1:10 (v/v) with pure water. One μL was used as template in a PCR that also included 10 μL 2X SYBR Green mix (Roche), 0.6 μL each forward and reverse primers (10 μM), and pure water for a final volume of 20 μL. Primers DXR-F (5’- A G T A G C G G A T G C G T T G A A G C) and DXR-R (5’- G C G G A T G A A T G A C A A T C T C T A T A T C G) were used in these experiments. cDNA loading in individual reactions was normalized to the levels of APT1 and RP2ls genes, whose sequence and stability under these conditions were previously reported [36 (link)]. Six individual plants were used for each transgenic or wild type line and each biological replicate was analyzed in three technical replicates for each gene of interest or normalizer. Relative fold calculations were performed using the efficiency corrected model [37 (link)].

All chemicals were of analytical grade and were purchased from Sigma-Aldrich (USA), Qualigens (India), Merck (India), Himedia (India) and SRL (India). LB media was purchased from Himedia (India). Ni⁺²-NTA resin, Protein G beads and Taq polymerase were purchased from Merck-Millipore (USA). cDNA synthesis kit was purchased from Thermo-Fisher (USA). Biorex-70 resin was purchased from Bio-Rad (USA). Cell culture chemicals were purchased from Sigma-Aldrich (USA) while cell culture plasticware was from Corning (USA). SYBR Green mix was purchased from Kapa Biosystems (USA).

We purified RNA from livers of 10 female and 6 male F1 mice using Trizol (Life Technologies, Grand Island, NY, USA) and synthesized cDNA using 1 μg of RNA and a cDNA synthesis kit (Life Technologies), then diluted the cDNA 20 times and used 3 μl of the diluted cDNA per qPCR reaction. For each gene target, we measured each sample in triplicate using the KAPA Biosystems SYBR Green Mix (Wilmington, MA, USA) in a 12 μl reaction volume and the following conditions: 95°C for 5 minutes, and 50 cycles of 95°C for 15 seconds, 60°C for 15 seconds, and 72°C for 15 seconds. We determined the absolute quantity of each transcript using a standard curve in the Roche Light Cycler 480 program, and normalized the quantity of each sample relative to the quantity of the house-keeping gene Rpl. We compared average levels of each transcript between females and males using a two-tailed t-test.

Total RNA from FHUVECs and MHUVECs were purified using the TriPure isolation reagent (Roche, Merk Life Science, Milano, Italy). First-strand cDNA synthesis was performed using Maxima reverse transcriptase (Thermo Fisher Scientific, Rodano, Italy) and random hexamers and subsequently analyzed by quantitative (q)PCR using SYBR Green mix (Kapa Biosystems, Merk Life Science, Milano, Italy).
The relative mRNA expression levels were calculated by the 2^−ΔCt method and GAPDH mRNA levels were used for normalization. Gene-specific primer pairs are listed in Table S1.

Total RNA from isolated PBMCs was extracted using TRIZOL reagent. RNA was reverse transcribed into cDNA using VERSO cDNA synthesis kit (Thermo Scientific) according to manufacturer’s instructions. As template, approximately 30 ng cDNA was used for RT-qPCR and the signals were detected using real-time PCR system. Quantitative real-time PCR was performed using Mastercycler ep realplex (Eppendorf). The cDNA was amplified using SYBR Green Mix (Kapa Biosystems) with gene-specific primers (Table S4 in Supplementary Material). The thermal cycler parameters followed are as follows: one cycle of 94°C for 2 min followed by 40 cycles of 30 s at 94°C, 30 s annealing at 56°C and 40 s at 68°C. The relative mRNA expression of each gene was calculated using housekeeping gene β-actin as the reference gene (33 (link)).

RNA was isolated from AFCs using the TriPure isolation reagent (Roche, Merk Life Science, Milano, Italy). First-strand cDNA synthesis was performed using Maxima Reverse Transcriptase (Thermo Fisher Scientific, Rodano, Italy) and random hexamers, and was subsequently analyzed by quantitative (q)PCR using SYBR Green mix (Kapa Biosystems, Merk Life Science, Milano, Italy). The relative mRNA expression levels were calculated by the 2−ΔCt method, and GAPDH mRNA levels were used for normalization. Pilot experiments showed that the housekeeping gene GAPDH did not differ between male and female cells (17.23 ± 1.38 mean Ct for females and 17.09 ± 0.35 for males, N = 5 for each sex; p = 0.80). Gene-specific primer pairs are listed in Supplementary Table S1.

RNA was isolated from PBMCs using the TriPure isolation reagent (F. Hoffmann-La Roche AG, Basel, Switzerland) and the PureLink RNA Mini Kit ((Thermo Fisher Scientific) following the manufacturers’ protocols. The concentration and the quality of RNA were evaluated with the Thermo Scientific ™ NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific). Total RNA was reverse-transcribed into cDNA using Maxima reverse transcriptase (Thermo Fisher Scientific) and analyzed by (q)PCR analysis using SYBR Green mix (Kapa Biosystems, Wilmington, MA, USA) and gene-specific primers (forward 5′-3′ TGTAAGAGGCTGCAAGGTGA; reverse 5′-3′ ATGCTGAAATGGGGCTGTTG). Relative mRNA expression levels were calculated by the 2^−ΔCt method using glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as an internal control.