Mir nc

The miR-145 mimic and miR-NC were purchased from Invitrogen. The cells were transfected with miR-145 mimic or miR-NC using Lipofectamine RNAiMAX (Invitrogen), according to the manufacturer’s instructions. In brief, mirVana miRNA mimic hsa-miR-145-5p (Thermo Fisher Scientific Company) or mirVana miRNA mimic NC #1 (Thermo Fisher Scientific Company) was diluted to 30 μM and mixed with diluted Lipofectamine RNAiMAX reagent. After being incubated at room temperature for 5 min, the mixture was then added to the cells accordingly, and the plates were incubated at 37 °C for one day.

Small interfering RNAs (siRNAs) specifically targeting PSMA3-AS1, negative control siRNA (si-NC), miR-302a-3p mimics and miR-NC were provided by Shanghai GenePharma Co., Ltd. (Shanghai, China). The sequence of PSMA3-AS1 siRNA, miR-302a-3p mimics and miR-NC are as below: si-PSMA3-AS1-1: 5′- UCUCGAAAACCCGAAAGAGAA-3′; si-PSMA3-AS1-2: 5′-UUCUAAGAACCACUUCUUCCC-3′; miR-NC: 5′-UCACAACCUCCUAGAAAGAGUAGA-3′; miR-302a-3p mimics: 5′-UAAGUGCUUCCAUGUUUUGGUGA-3′; miR-302a-3p inhibitor: 5′-UAAGUGCUUCCAUGUUUUGGUGA-3′. By reference to the manufacturer’s protocol, Lipofectamine 2000 kit (Invitrogen, CA, U.S.A.) was used to transfect LN229 and U251.

The sequences of let-7g mimic and negative control miRNA (NC-miR) (Life Technologies) are: let-7g mimic, 5′- UGAGGUAGUAGUUUGUACAGUU -3′; negative control sequence, 5′-AGUACUGCUUACGAUACGG-3′. The NC-miR has been extensively tested and validated to produce no identifiable effects on known miRNA function in human cells or tissues. By using Lipofectamine 2000 reagent (Sigma) or HiPerFect transfection reagent (Qiagen), let-7g mimic or NC-miR was transfected into THP-1 derived macrophages for 24 hours. For siRNA transfection, we used the following products: universal negative control siRNA#1 (Sic001, Sigma-Aldrich), RelA siRNA (SASI_Hs01_00171091, Sigma-Aldrich), p105 siRNA (SASI_Hs01_00227679, Sigma-Aldrich), RelB siRNA (SASI_Hs01_00103187, Sigma-Aldrich), p100 siRNA (SASI_Hs01_00138464, Sigma-Aldrich).

Cells were seeded at a density of 4.5 × 10⁴ cells/well in 6-well cell culture plates. At 70 – 90% cell confluence, cells were treated with 50 μM quercetin for 96 h, or were transfected with mirVana™ mimics of hsa-let-7c or a non-coding miR control (miR-NC) for 96 h (Thermo Fischer Scientific, Waltham, MA USA) using lipofectamine RNAiMax reagent (Life Technologies, Darmstadt, Germany), or were left untransfected. The cells were washed, fixed with methanol, washed and incubated with FAST BCIP/NBT (Sigma-Aldrich, St. Louis, Missouri, USA), washed, and the deep bluish purple color of alkaline phosphatase expressing osteoblasts was visualized under 10× magnification using an inverted microscope (Nikon Eclipse TS100; Nikon GmbH, Düsseldorf, Germany). The Sigma FAST BCIP/NBT active substrate solution containing BCIP (0.15 mg/ml), NBT (0.30 mg/ml), Tris buffer (100 mM), and MgCl2 (5 mM), pH 9.25–9.75 was prepared by dissolving one tablet in 10ml of water.

mirVana miR-210-3p miRNA mimic (MC10516), mirVana miRNA inhibitor (MH10516) and negative control (miR-NC) were purchased from Ambion (Thermo Fisher Scientific). Forty-eighth hours before transfection, 2.5 × 10⁶ SK-N-AS and SK-N-DZ cells were seeded in 10 ml of complete growth medium for each condition to reach 60–80% confluence at the time of the experiment. Cells were reverse-transfected using Lipofectamine RNAiMAX (Invitrogen, 13778–075) in OPTI-MEM reduced serum medium (Gibco, 31985–062). At the time of transfection, the medium was replaced with growth medium without FBS, and the transfection mix was prepared according to the manufacturer’s protocol. Cells where then incubated in normoxic or hypoxic conditions. 48 h later, EVs isolation and RNA extraction from EVs and cells was performed.