Maxima sybr green master mix

RNA was isolated using the TRIzol reagent (ThermoFisher) and cDNA prepared using the High-Capacity cDNA Reverse Transcription kit (ThermoFisher). cDNA was diluted 1:200 and used as a template in reactions using 2× Maxima SYBR green master mix (ThermoFisher). Samples were analyzed on an MX3000P qPCR system (Agilent Technologies) and fold-change calculated by the ΔΔC_T method.

Cells treated with Teniposide were processed using the SimpleChIP Plus Enzymatic kit (Cell Signaling, Danvers, MA) as per manufacturer’s protocol. Briefly, cells were fixed with 1% formaldehyde at room temperature. Then nuclei were isolated followed by chromatin digestion using micrococcal nuclease and sonication. Cross-linked chromatin (10 μg) was immunoprecipitated using 2 μg of anti-IRF-7 (Cell Signaling) or anti-ZEB2 (Bethyl Labs, Montgomery, TX). The precipitated chromatin was then eluted from the precipitate and cross-links were reversed. The immunoprecipitated DNA and input were analyzed by RT-qPCR using 2× Maxima SYBR Green Master Mix (Thermo Fisher). To detect interferon regulatory factor 7 (IRF7) occupancy at the NMI basal promoter elements, the following primer pairs were used:
For-CGGAAACTTCAGGTATACTTC, Rev-CTGCTTTAACGGCGATTTTTC.
To detect ZEB2 occupancy at the rDNA, the primer pairs used were as follows:
For-GTACTTTTAGTAGAGACGGTG, Rev-CACTTTGGGAGGCTAAGGC.
Threshold cycle (C[T]) values of input DNA were used to calculate the percent input of immunoprecipitation. Percent Input = 2% × 2^{(C[T] 2% Input Sample−C[T] IP Sample)}. Percent enrichment in comparison with corresponding controls is depicted. Each reaction was done in triplicate using an Applied Biosystems StepOnePlus (Thermo Fisher).

The expression of the genes identified by in silico analysis was validated by RTq-PCR for cDNA obtained from the archival tissue biopsies, plasma, and cells. Approximately 50 ng of the gene-specific cDNA obtained from AS, LC, and AC tissues, as well as lung cancer and asthmatic cells and plasma, was added to 2× maxima SYBR green master mix (Thermo Fisher Scientific, Waltham, MA, USA) along with the primers as listed in Supplementary Table S1. The reaction was carried out in a Quant Studio 3 cycler (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s instructions. The cycling conditions were an initial single hold stage at 50 °C for 2 min, 95 °C for 10 min, and then 40 cycles of 95 °C for 15 s, 60 °C for 1 min, and 95 °C for 15 s; there was then a melt-curve stage: 60 °C for 1 min and 95 °C for 1 s. Each cDNA reaction was performed in triplicate, and each experiment was repeated three times along with a negative cDNA sample and a negative non-template control for each pair of primers. The Ct value of the gene of interest was normalized against the expression of the housekeeping gene (18S) for each sample, and the relative gene expression (2^−ΔΔCt) was derived from the ΔCt values [32 (link),33 (link)]. The fold-expression values were normalized to log₂, and the relative expression of each gene was compared between the groups.

RNA was isolated from cells using the RNeasy Mini Kit (Qiagen, Hilden, Germany). One microgram total RNA was used to generate cDNA using High-Capacity cDNA kit (Thermo Fisher). Real-time PCR was performed using 40 ng total cDNA in each reaction, along with 2× TaqMan Fast Advance Master Mix (Thermo Fisher) and the following TaqMan primer probes: β-actin, NMI, CDH1, CDH2, KRT14, SNAI1, SNAI2, VIM, ZEB1, ZEB2 (Thermo Fisher).
RNA polymerase I (Pol I) transcription activity was quantitated by monitoring levels of 5′ external transcribed spacer (ETS) of the 47S pre-RNA using RT-PCR. cDNA (1:50 dilution) was used with 2× Maxima SYBR Green Master Mix (Thermo Fisher) along with the following primer sets to perform the reaction [25 (link)]:
Human 5′ETS 851–961 For-GAACGGTGGTGTGTCGTT, Rev-GCGTCTCGTCTCGTCTCACT; β-actin For-CATGTACGTTGCTATCCAGGC, Rev-CTCCTTAATGTCACGCACGAT.
Mouse 45S rRNA ITS1 For-CCGGCTTGCCCGATTT, Rev-GGCCAGCAGGAACGA; β-actin For-GGCTGTATTCCCCTCCATCG, Rev-CCAGTTGGTAACAATGCCATGT.
Applied Biosystems StepOnePlus Real-time PCR machine was used for the reactions (done in triplicate). Analysis was done using ^ΔΔCT to determine relative fold changes in mRNA or 5′ETS transcripts.

Cells were exposed to 4 Gy irradiation or treated with 2.5 µM NU7441 (DNA-PKcs i) or 5 µM KU-55933 (ATM i) 1 h prior to irradiation, followed by RNA extraction at times indicated post-irradiation, using the RNeasy Mini Kit (Qiagen, Hilden, Germany). All non-irradiated controls were collected in conjunction with the 1 h post-irradiated cells. cDNA was generated using 1 µg total RNA and the High Capacity cDNA kit (Thermo Fisher). Real-time PCR was performed using 40 ng total cDNA per reaction, 2× TaqMan Fast Advance Master Mix or Maxima 2X SYBR Green Master Mix (Thermo Fisher), and the following primers: TCOF1 For- CGG GAG CTA CTT CCC CTG AT; Rev- CAG AAG GGT TAC GGG CTG AG and ACTB For- CATGTACGTTGCTATCCAGGC; Rev-CTCCTTAATGTCACGCACGAT or TaqMan primer probes: β-actin or GLI1 (Thermo Fisher).
The rate of RNA Pol I transcription was measured by determining short-lived 5’ external transcribed spacer (5’ETS) rRNA of the 47S pre-RNA by real-time PCR. Reactions were performed with 2 µl of 1:50 diluted cDNA with 2× Maxima SYBR Green Master Mix (Thermo Fisher) along with the following primer sets (11)(11)(7)- 5’ETS 851–961 forward: GAACGGTGGTGTGTCGTT; reverse: GCGTCTCGTCTCGTCTCACT.
Reactions were run in triplicate using Applied Biosystems StepOnePlus Real-time PCR machine. Analysis was done using ^ΔΔCT to determine relative fold changes in mRNA or 5’ETS transcripts.