Total RNA was isolated from cells that underwent different treatments using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA), and 1 μg of total RNA was reverse transcribed to cDNA with the HiFi-MMLV cDNA First Strand Synthesis Kit (CW Bio, Shanghai, China). Quantitative PCR was performed by combining cDNA with GoTaq qPCR Master Mix (Promega, Madison, WI, USA). The reaction was carried out with the CFX96 Real Time PCR Detection System (Bio-Rad) using the following conditions: 95°C for 2 minutes, 95°C for 15 seconds, 60°C for 30 seconds, and 72°C for 25 seconds, followed by 40 cycles of 95°C for 15 seconds and 60°C for 2 minutes. Quantification of mRNA expression was calculated by the Livak method as described by the manufacturer instructions, shown in a 2-ΔΔCt method, and was finally presented in a column graph using Graphpad Prism 7 (La Jolla, San Diego, CA, USA).
Hifi mmlv cdna first strand synthesis kit
Manufactured by CWBIO
Sourced in China
The HiFi-MMLV cDNA First Strand Synthesis Kit is a laboratory product designed for the synthesis of cDNA from RNA samples. The kit utilizes a high-fidelity reverse transcriptase enzyme to generate first-strand cDNA from total RNA or poly(A)+ RNA.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (11 mentions)
Gotaq qpcr master mix, by Promega (8 mentions)
Cfx96 real time system, by Bio-Rad (8 mentions)
Ultrapure rna extraction kit, by CWBIO (3 mentions)
Trizol ls reagent, by Thermo Fisher Scientific (3 mentions)
Ultrasybr mixture, by CWBIO (3 mentions)
Ultrapure rna kit, by CWBIO (2 mentions)
Abi prism 7500, by Thermo Fisher Scientific (2 mentions)
Gotaq qpcr master mix, by Tiangen Biotech (2 mentions)
Cfx96 real time pcr detection system, by Bio-Rad (1 mentions)
Dnase 1 kit, by CWBIO (1 mentions)
Cw0581, by CWBIO (1 mentions)
Lightcycler 480, by Roche (1 mentions)
Trizol reagent, by Solarbio (1 mentions)
Evans blue, by Merck Group (1 mentions)
Glial fibrillary acidic protein (gfap), by Abcam (1 mentions)
P β catenin, by Abcam (1 mentions)
P smad3, by Abcam (1 mentions)
Vascular endothelial growth factor (vegf), by Abcam (1 mentions)
Smad3, by Abcam (1 mentions)
23 protocols using hifi mmlv cdna first strand synthesis kit
1
Quantitative Analysis of Gene Expression
2
Quantifying IGF1 Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The changes in the expression of IGF1 was further validated by SYBR Green I real‐time polymerase chain reaction (PCR). Three rats from each group were used for this analysis. The total RNA of tissue samples was extracted by an ultrapure RNA extraction kit in accordance with the product instructions (CWbio, catalog #CW0581). We utilized 5μl RNA 1% agarose gel electrophoresis to detect the integrity of the RNA, and then used DNase I kit (CWbio, catalog #CW2090) and HiFi‐MMLVcDNA first strand synthesis kit (CWbio, catalog #CW0744) to digest residual genomic DNA in RNA and reverse transcription, respectively. The expression level was measured by quantitative real‐time PCR running on the ABI 7500 system following the product instructions. Relative quantitative data was calculated by the comparative Ct method (2‐△△CT).24
3
Quantitative Real-Time PCR for mRNA Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mRNA levels were determined by real-time quantitative RT-PCR (qRT-PCR). In brief, total RNA was prepared from each tissue sample (50 mg) using TRIzol reagent according to the manufacturer's protocol according to the manufacturer's instructions (Invitrogen Life Technologies, USA). cDNA synthesis was conducted using the HiFi-MMLV cDNA first strand synthesis kit (CWbio Co., Ltd, Cat#CW0744, China). The gene-specific primer pairs are listed in Table 1 . qRT-PCR was performed using an ABI 7500 real-time PCR thermocycler instrument (ABI, Norwalk, CT). qRT-PCR was conducted in a 20-μl reaction system containing 1 μl cDNA, 0.5 μl forward primers (10 μM), 0.5 μl reverse primers (10 μM), 10 μl SYBR Green Supermix, and 8.0 μl water. The fold change was calculated using the 2−ΔΔCt method [38 (link)].
4
Comparative Quantification of CircRNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNAs were reverse transcribed with the HiFi‐MMLV cDNA first strand synthesis kit (CWBIO). qRT‐PCRs were performed on a 96‐well format Roche LightCycler 480 real‐time PCR machine to compare the levels of the two circRNAs between the case and control groups. The relative fold changes were calculated by the comparative threshold cycle method, and GAPDH was used as the internal normalization control. Primers are listed in Table 3 . The dissociation curve of each sample was then assessed. CircRNA levels were calculated by the ΔCt method with GAPDH as the control. Larger ΔCt values indicate lower expression. All data in this study were expressed as the mean ± standard deviation (SD) of two independent experiments.
5
Quantifying TLR2 and Sphk1 Expression in Ischemic Brain
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A fluorescence quantitative PCR method was used to measure the mRNA levels of TLR2 and Sphk1 in ischemic brain tissue. Each group of mice after 12, 24 or 48 h of reperfusion were then anesthetized with 10% chloral hydrate (3.5 ml/kg body weight) by intraperitoneal injection. The ischemic side brain tissue was storeed at −80°C in a low temperature freezer for future use. Primers for the real-time PCR detection of the target gene were designed and synthesized by Beijing Kangwei Century Biotechnology Co. and were as follows: TLR2 forward, CAGTCCCAAAGTCT AAAGTC and reverse, CTACGGGCAGTGGTGAAAAC, amplification product 166 bp; Sphk1 forward, GGAACC AGTAGAATGCCCTC and reverse, GGTTCTTCCGTTCGG TGAGT, amplification product 173 bp. An ultrapure RNA extraction kit (cat no. CW0581; CW Bio. Co., Ltd., Beijing, China) was used to extract total RNA amount from the tissue. Samples containing 5 μl RNA were assessed with 1% agarose gel electrophoresis, and a HiFi-MMLV cDNA first-strand synthesis kit (cat no. CW0744; CW Bio. Co., Ltd.) was used to perform reverse transcription. Using an LC-480II quantitative PCR machine, the 2−ΔΔCT method was used for the quantitative analysis of related data. Each sample was analyzed in duplicate.
6
Quantitative Real-Time PCR for Inflammatory Pathway
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from the cortical brain tissue or primary cultured neurons, lysed in Trizol reagent (Invitrogen) to recover the total RNA according to the manufacturer’s protocol (Trizol™ Reagent, Invitrogen). The total RNA was reversely transcripted to cDNA using a HiFi-MMLV cDNA First Strand Synthesis Kit (CW Bio, China). Quantitative real-time PCR was performed using GoTaq qPCR Master Mix (Promega) on the CFX96TM Real-Time System (Bio-Rad). GAPDH was amplified in parallel as an internal control. Primer sequences as follow, TLR4 F: 5′- TCACAACTCGCCCAAGGAGGAA -3′, R: 5′- AAGAGACCACGGCAGAAGCTAG -3′; MyD88 F: 5′- CCACCTGTAAAGGCTTCTCG -3′, R: 5′- CTAGAGCTGCTGGCCTTGTT -3′; NLRP3 F: 5′- GCTAAGAAGGACCAGCCAGAGT- 3′, R: 5′- GAACCTGCTTCTCACATGTCGT -3′; GAPDH: F: 5′- AACTTTGGCATTGTGGAAGG -3′ R: 5′- GGATGCAGGGATGATGTTCT -3′.
7
qPCR Analysis of Hippocampal Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
qPCR analysis was performed as previously described (Cao et al., 2021 (link)). The bilateral hippocampal tissues of Control group, Con-AAV-KA group, and AAV-RNAi-KA group were collected for RT-qPCR analysis. Total RNA from hippocampal tissues was prepared with TRIzol reagent according to the manufacturer’s protocol (TrizolTM Reagent, Thermo Scientific). The total RNA was reverse-transcribed to cDNA using a HiFi-MMLV cDNA first-strand synthesis kit (CW Bio, Beijing, China). qPCR was performed using GoTaq qPCR Master Mix (Promega) on the CFX96TM real-time system (Bio-Rad). The expression of the genes of interest was normalized to the levels of GAPDH. Primer sequences used for qPCR are listed below:
8
Extracting and Reverse Transcribing RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from the serum and placental tissue using TRIzol LS Reagent (Invitrogen, Karlsruhe, Germany) and TRIzol Reagent (Invitrogen), respectively, according to the manufacturer’s instructions. The purity of the extracted RNA was measured by a UV spectrophotometer using the following criteria: the 260/280 nm absorbance ratio of a qualified sample should be between 1.8 and 2.1. Among the extracted RNA samples, the number of sample failures in the second trimester and third trimester was kicked out by six and nine, respectively. RNA was reverse-transcribed into cDNA using HiFi-MMLV cDNA first strand synthesis kit (CWBIO) under the following conditions: 42 °C for 50 min, 85 °C for 5 min, and immediately stored at − 80 °C until use.
9
Quantification of MLKL Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted from samples using TRIzol reagent (Solarbio). Total RNA was reversely transcribed to cDNA using a HiFi-MMLV cDNA First Strand Synthesis Kit (CW Bio, Beijing, China). Quantitative real-time PCR was performed using GoTaq qPCR Master Mix (Promega) on the CFX96TM Real-Time System (Bio-Rad, Hercules, CA). Primer sequences were as follows: MLKL: F: 5´ -ACCCTTCAGAGGCACAACAC- 3´, R: 5´ -TGTCATTGGATTCGGTGGGG-3´; GAPDH: F: 5´ -AACTTTGGCATTGTGGAAGG- 3´, R: 5´ -GGATGCAGGGATGATGTTCT- 3´.
10
Quantitative RT-PCR Analysis of NLRP3
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We lysed total RNA using Trizol reagent (Invitrogen, Carlsbad, CA, United States) and performed reverse transcription to cDNA using a HiFi-MMLV cDNA First-Strand Synthesis Kit (CW-Bio, Beijing, China). We conducted quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis using GoTaq qPCR Master Mix (Promega) and the CFX96TM Real-Time System (Bio-Rad, Hercules, CA, United States). We used GAPDH as an internal control. The primer sequences were as follows: NLRP3 F: 5′-GCTAAGAAGGACCAGCCAGAGT-3′, R: 5′-GAACCTGCTTCTCACATGTCGT-3′; GAPDH: F: 5′-AACTTTGGCATTGTGGAAGG-3′ R: 5′-GGATGCAGG GATGATGTTCT-3′.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!