Mutations at sites 2063, 2064, and 2617 in the M. pneumoniae 23S rRNA gene domain V region were detected by direct sequencing of samples with a positive PCR result as described elsewhere (39 (link), 40 (link)). Briefly, by mixing primers (Sigma-Aldrich, China), Taq polymerase (TaKaRa Bio, Inc., Shiga, Japan), and extracted DNA, nested PCR was performed with a thermal cycler (TaKaRa Bio, Inc., Shiga, Japan). The purified PCR products were labeled with a BigDye Terminator version 3.1 cycle sequencing kit (Applied Biosystems, Foster City, CA, USA) and applied to an ABI Prism 3130xl genetic analyzer (Applied Biosystems, Foster City, CA, USA) in accordance with the manufacturer’s instructions. A sequence scanner (Applied Biosystems, Foster City, CA, USA) was used to determine gene mutations at each site.
Sequence scanner
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Sequence Scanner is a lab equipment product designed for DNA sequence analysis. It is used to capture and process genetic sequence data from various samples. The core function of the Sequence Scanner is to provide accurate and reliable DNA sequencing capabilities for research and diagnostic applications.
Automatically generated - may contain errors
Lab products found in correlation
Chromaspro, by Technelysium (2 mentions)
Abi 3730, by Thermo Fisher Scientific (2 mentions)
Thermal cycler, by Takara Bio (1 mentions)
Bigdye terminator version 3.1 cycle sequencing kit, by Thermo Fisher Scientific (1 mentions)
Taq polymerase, by Takara Bio (1 mentions)
Abi prism 3130xl genetic analyzer, by Thermo Fisher Scientific (1 mentions)
3500xl genetic analyzer, by Thermo Fisher Scientific (1 mentions)
Bigdye terminator 3.1 kit, by Thermo Fisher Scientific (1 mentions)
Mutation surveyor, by SoftGenetics (1 mentions)
Exosap it purification kit, by GE Healthcare (1 mentions)
Taq polymerase 5 u, by Promega (1 mentions)
Bigdye terminator kit version 1, by Thermo Fisher Scientific (1 mentions)
3730xl genetic analyzer, by Thermo Fisher Scientific (1 mentions)
Genomic dna purification kit, by Thermo Fisher Scientific (1 mentions)
Sequencing analysis 5, by Thermo Fisher Scientific (1 mentions)
Bioedit, by Technelysium (1 mentions)
Qiaamp dna mini kit, by Qiagen (1 mentions)
Onestep rt pcr kit, by Qiagen (1 mentions)
Hotstartaq master mix kit, by Qiagen (1 mentions)
Bigdye terminator v3.1 cycle sequencing kit, by Thermo Fisher Scientific (1 mentions)
18 protocols using sequence scanner
1
Detecting M. pneumoniae 23S rRNA Mutations
2
HBV Genotyping and Mutation Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HBV genotypes were determined by both phylogenetic trees comparing with standard sequences in GenBank database (Supplementary
3
Sanger Sequencing of ALPL Gene Exons
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The search for mutations in the exons of the ALPL gene was performed using Sanger sequencing. DNA was isolated from dry blood spots or whole blood by phenol-chloroform extraction. Special primers were developed for each exon in the ALPL gene. PCR conditions were selected individually for each exon. The synthesized PCR products were purified with 5 m NH4Ac and 96% ethanol, and then 70% ethanol, dried at 60 °C and dissolved in 10 µL of deionized water. Further, the purified PCR products were sequenced using the reagent BigDye Terminator 3.1 kit (Applied Biosystems, Waltham, MA, USA). Then, capillary electrophoresis was performed in a genetic analyzer 3500xl (Applied Biosystems, Waltham, MA, USA). The obtained exon sequences were analyzed using the Sequence Scanner (version 2.0, Applied Biosystems, Waltham, MA, USA) software. The presence of the mutation was confirmed by visual inspection of the sequencing chromatograms.
4
Genetic Variant Analysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
Mutations and polymorphisms were detected by software and programs including ChromasPro (Technelysium, South Brisbane Australia), Sequence Scanner (Applied Biosystems, US), Mutation Surveyor (SoftGenetics, Pennsylvania, USA), and nucleotide blast program of NCBI. These ones were then identified by comparison with the reference sequence in GenBank (www.ncbi.nlm.nih. gov/genbank), available genetic data in PAH database (http://www.PAHdb.mcgill.ca ), and SNP database of NCBI (www.ncbi.nlm.nih.gov/snp ).
The clinical significance of mutations was characterized by using ClinVar (www.ncbi.nlm.nih.gov/clinvar/ ) database. The analysis
of new variants was carried out by Mutation Taster (http://www.mutationtaster.org/ ) and CADD (http://cadd.gs.washington.edu/ )
online bioinformatics tools.
+ Expand
Mutations and polymorphisms were detected by software and programs including ChromasPro (Technelysium, South Brisbane Australia), Sequence Scanner (Applied Biosystems, US), Mutation Surveyor (SoftGenetics, Pennsylvania, USA), and nucleotide blast program of NCBI. These ones were then identified by comparison with the reference sequence in GenBank (www.ncbi.nlm.nih. gov/genbank), available genetic data in PAH database (
The clinical significance of mutations was characterized by using ClinVar (
of new variants was carried out by Mutation Taster (
online bioinformatics tools.
5
16S rRNA Gene Amplification and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total DNA extracted from samples was used as a template for the amplification of a fragment of the 16S ribosomal DNA by polymerase chain reaction (PCR). Amplification was performed using the highly conserved universal primers: Fd1 5′-AGAGTTTGATCCTGGCTCAG-3′ and RP2 5′-ACGGCTACCTTGTTACGACTT-3′ [25 ].
The PCR reactions were carried out using a TC1000-G thermocycler (DLAB Scientific), in a total volume of 15 μL containing approximately 100 ng of genomic DNA, 0.3 μL of each 10 mm dNTP (Promega), 3 μl of 5X buffer (Promega), 0.9 μL of 25 mm MgCl2 (Promega), 0.12 μL of each 10 mm primer, and 0.075 μL of Taq polymerase 5 U (Promega). The PCR was programmed as follows: 95°C, 2′/(95°C, 40″-55°C, 40″-72°C, 1′) ×35; 72°C/5′/4°C.
The PCR products were purified using the ExoSAP-IT purification kit (GE Healthcare), and sequencing was performed with the BigDye Terminator Kit version 1.0 (Applied Biosystems).
Sequencing products were separated and detected in a 3730xl Genetic Analyzer (Applied Biosystems). Chromatogram revision and trimming was performed with the sequence scanner (Applied Biosystems), and alignment was obtained from ClustalX implemented in BioEdit [26 ].
The PCR reactions were carried out using a TC1000-G thermocycler (DLAB Scientific), in a total volume of 15 μL containing approximately 100 ng of genomic DNA, 0.3 μL of each 10 mm dNTP (Promega), 3 μl of 5X buffer (Promega), 0.9 μL of 25 mm MgCl2 (Promega), 0.12 μL of each 10 mm primer, and 0.075 μL of Taq polymerase 5 U (Promega). The PCR was programmed as follows: 95°C, 2′/(95°C, 40″-55°C, 40″-72°C, 1′) ×35; 72°C/5′/4°C.
The PCR products were purified using the ExoSAP-IT purification kit (GE Healthcare), and sequencing was performed with the BigDye Terminator Kit version 1.0 (Applied Biosystems).
Sequencing products were separated and detected in a 3730xl Genetic Analyzer (Applied Biosystems). Chromatogram revision and trimming was performed with the sequence scanner (Applied Biosystems), and alignment was obtained from ClustalX implemented in BioEdit [26 ].
6
Purification and Sequencing of PCR Products
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR products were purified with Wizard® DNA Clean-Up System, following the manufacturer's protocol and quantified in a Nanodrop 2000c. After that, PCR product (200 ng) and forward primer (200 ng) for the studied genes were used for sequencing using a Sequence Scanner (Applied Biosystems). The results were analyzed in the BioEdit program (Ibis Biosciences, Carlsbad, CA, USA).
7
Amplification and Sequencing of ARG Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ARG gene was amplified by conventional PCR from promastigote DNA. DNA from LIC.B, LII.S, LIC.B and LIC.S parasites was extracted using the Genomic DNA Purification Kit protocol (Thermo Fisher). Conventional PCR was performed with 50 ng DNA, GoTaq® Hot Start Master Mix 2x (Promega), specific primers (5’ CGCATATGATGGAGCACGTGCA 3’ and 5’ CGGGATCCCTACAGTTTGGCG 3’ ) and DEPC-treated water up to 25 μL. PCR amplification was performed with a programmable thermal cycler (Applied Biosystems). The amplification protocol was carried out as follows: 1 cycle at 95°C; 30 cycles of 30 s at 94°C, 30 s at 58°C, and 40 s at 72°C; and 1 cycle of 5 min at 72°C. Next, 200 ng of purified DNA and specific primers (described above) were used for Sanger sequencing using a Sequence Scanner (Applied Biosystems). The results were analyzed using the BioEdit program (Ibis Biosciences, Carlsbad, CA, USA).
8
Sequence Alignment and Phylogenetic Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quality check and editing of the obtained sequences was done using the software SequenceScanner (Applied Biosystems) and BioEdit [27 ]. Alignment and curation of sequences was done with the program MEGA 5.2 [28 (link)] and ClustalW. Sequences were concatenated with DAMBE 5.3.9 [29 (link)] and MEGA 5.2 was used to construct a Neighbor-Joining Tree with standard settings. The pairwise deletion option was used to treat missing data and gaps; finally the tree was tested with 100 bootstrap replicates.
9
Mitochondrial DNA Sequencing Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We carried out mtDNA analysis as previously described.19 (link) Briefly, the raw image data of Mitochip were initially processed into sequence data by Affymetrix Sequence Analysis Software 4.1, an ABACUS algorithm based software, according to the manufacturer suggested procedures. The sequence data were then analyzed by the Sequencing analysis 5.2 (Applied Biosystems, USA), Sequence Scanner (Applied Biosystems, USA), ChromasPro (Technelysium Pty. Ltd.), and BioEdit (version 7.0.9). The mtDNA variations were identified by comparing with the reference mtDNA sequence (rCRS: Revised Cambridge Reference Sequence of the Human Mitochondrial DNA; GenBank: NC_012920). Insertions and deletions in the hypervariable regions I and II were determined by aligning 478 redundant fragments on the MitoChip with the public database (http://code.open-bio.org ) as previously described.20 (link) As the low prevalence of heteroplasmy could not be differentiated from technical errors, only the homoplasmy data were used to determine the somatic mutations. For matched samples, somatic mtDNA mutations were evaluated by comparing mtDNA sequences of the tumor cells with those of the matched normal lymphocytes.
10
Comprehensive p53 Mutational Analysis
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!