Pyromark q24 2

DNA methylation percentages of five different CpG island sites included in the microarray (two in CD14, three in HLA-DOA) were analysed and quantified by pyrosequencing. Bisulfite-converted DNA was previously amplified by PCR using Hot-Start GoTaq polymerase (Promega, Madison, WI) under the following conditions: 1 ul of DNA, 4 ul of 5X polymerase buffer, 0.2 mM dNTPs, 0.6 mM MgCl2, 0.3 μM of either biotin-labelled forward or reverse primers and 0.05 U/μl Hot-start Go Taq Flexi polymerase (Promega). PCR protocol was performed as follows: initial denaturation at 94 °C for 2 min, 35 cycles of 94 °C 10 s, 64 °C (CD14) or 60 °C (HLA-DOA) 10 s and 72 °C 50 s and a final extension step of 72 °C 7 min. Details of amplicon and primer sequences are provided in Additional file 5: Table S3. PCR products were verified using the QIAxcel DNA high-resolution electrophoresis system. Pyrosequencing of methylated sites was performed using the PyroMark Q24 (Qiagen) according to the manufacturer’s protocol. The methylation level was assessed using the PyroMark Q24 2.0.6 Software (Qiagen) by which the methylation percentage (mC/mC+C) for each CpG was calculated. The results are presented as the percentage (mean ± SD) of the different CpG sites studied for each of the CpG sites analysed whose sequences and relative positions are also shown as Additional file 5: Table S3.

DNA methylation signatures of promoter segments of NANOG, NFE2L2, and STAT3 were analyzed using a Qiagen Pyromark Q24 sequencer as previously described (Plos One Jenke et al.). Briefly, after standard sodium bisulfite conversion using the EZ DNA Methylation-Gold Kit (Zymo Research, USA) pyrosequencing methylation analysis was conducted using the Pyromark Q24 (Qiagen, Germany) according to the manufacturer’s protocol. Therefore, we designed and made use of the following oligonucleotides: 1. for NFE2L2—primer F1 (5′- gga gtt aga ggg gat agt ggt t-3′), 5′-biotinylated primer (5′-acc cca cca aat caa aac ttc ct-3′), and sequencing primer S1 (5′-agg gta aag gag gat g-3′); 2. for STAT3—primer F1 (5′-ggt gta ggg tgg ggt tat t-3′), 5′-biotinylated primer (5′-acc cta tat atc tcc tcc tat cct-3′), and sequencing primer S1 (5′-ggg tgg ggt tat ttt t-3′); 3. for NANOG (DNA methylation positive control)—primer F1 (5′-gta gga tag gaa tgg ggg ttg-3′), 5′-biotinylated primer (5′-acc tta aat tta ccc caa att cta c-3′), and sequencing primer S1 (5′-aat ggg ggt tgg gga-3′). No reliable NOS3 DNA methylation assays meeting our quality standards could be designed. The level of methylation was analyzed using Pyromark Q24 2.0.6 Software (Qiagen). Non-CpG cytosine residues and a standard fully methylated DNA (Zymo Research, USA) were used as controls to verify bisulfite conversion.

The methylation level of CpG sites was evaluated with pyrosequencing in the MCHC, and UTSW sets. Genomic DNA was extracted with the QIAamp DNA FFPE Tissue Kit (Qiagen, Valencia, CA, USA) following the manufacturer's recommendations. Bisulfite conversion was performed on one microgram of DNA with the EpiTect Bisulfite Kit (Qiagen). Twenty nanograms of converted DNA were used as a template in each subsequent PCR. Specific sets of primers for PCR amplification and sequencing were designed using the PyroMark^® Assay Design 2.0 software (Qiagen). Primer sequences are listed as follow: Forward primer: GTTTTTTAGGGAGGGGTTT; Reverse primer: AAAAATAAAATAAAACAAACCTTAAACCTTAT; Sequencing Primer: TTGTTTTTTATGTTT. PCRs were performed with the PyroMark PCR Kit (Qiagen) under the following conditions: 95°C for 15 min; 45 cycles of 94°C for 30 sec, 56°C for 30 sec, and 72°C for 30 sec; and an elongation step of 72°C for 10 min. The success of amplification was assessed by 2% agarose gel electrophoresis. PCR products were pyrosequenced with the PyroMark Q24 pyrosequencer (Qiagen) according to the manufacturer's protocol (Pyro-Gold reagents). Output data were analyzed using PyroMark Q24 2.0.6 Software (Qiagen). Controls to assess proper bisulfite conversion of the DNA were included in each run, and sequencing controls were used to ensure the fidelity of the measurements.

Genomic DNA was subjected to bisulfite modification and purification with the EpiJET bisulfite conversion kit (ThermoFisher Scientific, Vilnius, Lithuania, K1461), according to the manufacturer’s protocol. Briefly, 500 ng of DNA in 20 µL was added to a 120 µL modification reagent solution, mixed thoroughly, and incubated at 98 °C for 10 min and then at 60 °C for 4 h. The modified DNA was purified, subjected to de-sulfonation at room temperature for 20 min, washed, and dissolved in 40 µL elution buffer. The recovered DNA was used as a template in a methylation-specific polymerase chain reaction (PCR) to amplify the target DNA segment with biotin-labeled methylation-specific primers designed with Pyromark Assay Design Software 2.0 (Qiagen, Singapore). The primer sequences are shown in Supplemental Table S1. The PCR products were mixed with magnetic beads coated with streptavidin and isolated with a Pyromark Q24 Vacuum Workstation (Qiagen), followed by pyrosequencing with a PyroMark Q24 instrument (Qiagen). The sequencing signals were analyzed with Pyromark Q24 2.0.6 software (Qiagen).