TZM-gfp cells (15,000 per well) were seeded in 8-well chamber glass slides (ibidi) in DMEM/10 mendium and allowed to adhere overnight. The following morning the medium was replaced with 200ul of fresh DMEM10 without antibiotics. Purified protein mixtures (300 ng Rev+/− 300 ng Tat) were then transfected using 0.6uL of CrisprMAX reagent (Invitrogen) without Cas9 Plus Reagent, per manufacturer instructions. Cells were incubated 6 h, washed three times with fresh medium, then fed with 200uL fresh DMEM10 medium without antibiotics. Extracellular Tat was then added at 300 ng per well in 200uL total medium and incubated for 24–48 h. Live cells were analyzed by confocal microscopy for induction of GFP reporter signal using a Leica SP5 instrument.
Crisprmax reagent
Manufactured by Thermo Fisher Scientific
CrisprMAX reagent is a transfection reagent designed for the delivery of CRISPR components into cells. It is intended for use in CRISPR-Cas9 genome editing applications.
Automatically generated - may contain errors
Lab products found in correlation
Opti mem medium, by Thermo Fisher Scientific (2 mentions)
8 well chamber glass slide, by Ibidi (1 mentions)
Sambucus nigra lectin sna, by Vector Laboratories (1 mentions)
Hcm media, by Lonza (1 mentions)
Spcas9 protein, by Integrated DNA Technologies (1 mentions)
Facsmelody cell sorter, by BD (1 mentions)
6 protocols using crisprmax reagent
1
Visualizing Tat-induced GFP Expression
2
CRISPR-Mediated Gene Knockout in hESF and HTR8 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gene knockout was achieved by using pre-prepared synthetic sgRNA (IDT). hESF (or HTR8) were transfected with sgRNA and recombinant Cas9 (IDT) using CRISPRmax reagent (Invitrogen). Specifically, a cocktail was created by mixing 1) solution1: 24 µL OPTIMEM and 1 uL CRISPRMAX, and 2) solution 2: 10 nmol gRNA, 15 nmol Cas9, 1.5 µL CRISPRMAX Plus reagent and remaining OptiMEM to make a 30 µL solution. Solution 1 and 2 were mixed and incubated for 15 min before being drop dispensed for a 24 well containing hESF, dESF, or HTR8 cells at 70%–80% confluency in culture medium with no serum. Cells were used after 48 h of transfection, and observation completed within 48 h thereafter.
3
RNA Transfection and Plasmid Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was transfected directly into eight-well chamber slides using the lipofectamine-based CRISPRMAX reagent following the manufacturers guidelines (Invitrogen). A final concentration of 62.5 nM RNA in 10 mM sodium phosphate buffer (pH 7.2), 100 mM KCl, and 1 mM MgCl2 was incubated at room temperature with a 1:1 dilution in OptiMEM prior to transfection. The RNA transfected was incubated at 37 °C for 1 h in complete growth medium. FuGene 6 was used to transfect 400 ng of the pSLQ--Mango and control plasmids directly in the eight-well chamber slides following the manufacturer’s instructions. Plasmids were left to express between 12–48 h before fixation as described below.
4
Single-Cell Screening of CMAS and ST6Gal1 Knockouts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Custom crRNA (IDT) was designed to target human CMAS (GAACACCCCCGATCTTCTCC) and ST6Gal1 (CAGATGGGTCCCATACAATT). Cells were seeded at 500,000 cells per well 1 day prior to transfection in a 6-well tissue culture plate. For one well of a 6-well plate, 20 pmol of Cas9 nuclease (IDT), 20 pmol of ATTO-550 labeled crRNA:tracrRNA (IDT) duplex, 8 μL Cas9 Plus reagent (IDT), and 16 μL CRISPRMAX reagent (Thermo Fisher) in 600 μL Opti-MEM medium (Gibco). One day after transfection, cells were removed from the plate by trypsin digestion, washed, resuspended in 300 μl of cell sorting medium (HBSS, 10% FBS, 1 mM EDTA), and stored on ice until sorting. Cells were sorted within the University of Alberta Flow Cytometry Core. The top 5% bright dyes stained with ATTO-550 were sorted into three 96-well plates containing regular culture medium at one cell per well. Cells were grown for ~2 weeks until a time when colonies were screened by flow cytometry using fluorescein-conjugated Sambucus Nigra Lectin (SNA, 1:750, Vector Laboratories).
5
Targeted Gene Editing in Murine Hepatocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Hepatocytes were isolated from 6 −12-week-old female mTmG mice on a C57BL/6 background by collagenase perfusion as previously described(10 (link)). A chemically modified synthetic single guide RNA (sequence: 5’-UCGUGGGGGUCCUGACCUAC-3’) targeting the mouse Cypor gene was obtained (Synthego). Along with spCas9 protein (Integrated DNA Technologies), sgRNA was delivered to primary hepatocytes using the CRISPRMAX reagent (Thermo Fisher Scientific) with modifications to manufacturer protocol. Briefly, the assembled ribonucleoprotein complexes were added to non-attached primary hepatocytes in suspension at 1×106 cells / mL in HCM media (Lonza). Cells were incubated with rocking at 37°C for 2 hours before transplantation. Hepatocyte transplantation was conducted by injecting 5×105 hepatocytes into the spleen. An aliquot of transfected cells was plated on a collagen-coated plate in HCM media and harvested at day 5 post-transfection for gDNA extraction and indel assessment.
6
Siglec-7 Knockout in U-937 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CRISPR RNA (crRNA) was designed to target human Siglec-7 (CATGCCCTCTTGCACGGTCA, IDT) in U-937 cells (ATCC® CRL-1593.2™). guide RNA (gRNA) (1 μM crRNA, 1 μM ATTO-550 labeled tracrRNA (IDT)) was boiled at 95°C for 5 min. A solution of 20 pmol gRNA, 20 pmol Cas9 nuclease (IDT), 8 μl Cas9 PLUS reagent (IDT), 16 μl CRISPRMAX reagent (Thermo Fisher) in 600 µl of Opti-MEM medium (Gibco) was prepared. 750,000 U-937 cells were washed with Opti-MEM medium (Gibco) and centrifuged at 300 x g for 5 min. The cell pellet was resuspended in the prepared solution and incubated at 37°C, 5% CO2. After a 24 h incubation, cells were centrifuged at 300 x g for 5 min, then resuspended in 400 μl flow buffer (HBSS, 1% FBS, 500 µM EDTA). The top 5% ATTO-550 positive cells were sorted on a BD FACSMelody™ Cell Sorter into four 96-well flat-bottom plates containing media at one cell per well. Approximately 2 weeks later, colonies were screened for Siglec-7 expression by flow cytometry using PE-conjugated Siglec-7 at 1:100 dilution (BioLegend) and Siglec-7-/- clones were collected.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!