CD4+ T cells were stimulated with anti-CD3 (2 μg/ml) and anti-CD28 (1 μg/ml) mAbs for 24 hours. Foxo3 ChIP experiments were performed using iDeal ChIP-Seq Kit for Transcription Factors (Diagenode, C01010055) with some modifications. Briefly, cells were fixed with 1% PFA during 15 minutes then glycine (0.250 mM) was added. Cells were then lysed with manufacturer’s buffers and sonicated with 15 cycles of 30sec ON/60 sec OFF using a bioruptor pico. Sonicated chromatin was incubated overnight at 4°C either with 5 μg of anti-Foxo3 antibody (Santa-Cruz, sc-11351X) or an IgG control. Chromatin was then washed and eluted using manufacturer’s recommendations. For ChIP analysis, QPCR was performed using SyberGreen Master mix (Roche) on a 480 LightCycler in duplicate with primers listed in Table S1 . Percent of Input was calculated using the following formula: 2^(adjusted INPUT-Ct (IP))*100 where adjusted INPUT = Ct INPUT − log2 (1).
Anti foxo3 antibody
Manufactured by Santa Cruz Biotechnology
Sourced in United States
The Anti-FOXO3 antibody is a laboratory tool used to detect and study the FOXO3 protein. FOXO3 is a transcription factor that plays a role in various cellular processes, such as cell cycle regulation, apoptosis, and stress response. This antibody can be used in techniques like Western blotting, immunoprecipitation, and immunohistochemistry to measure and analyze the expression and localization of FOXO3 in biological samples.
Automatically generated - may contain errors
3 protocols using anti foxo3 antibody
1
Foxo3 ChIP-Seq Protocol for CD4+ T cells
2
Endogenous ChIP Assay for FOXO3 Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Endogenous chromatin immunoprecipitation (ChIP) assay was performed with H1299 cells and anti-FOXO3 antibody (Santa Cruz) or IgG control antibody according to EZ-ChIP manufacturer's instructions (Millipore) [37 (link)]. PCR was performed with primers against GAPDH, p27 and three RRM2B promoter regions. Input DNA used was purified from the pre-cleared chromatin sample. Primers are listed in the supplementary table 1 .
3
FOXO3 Binding Quantification on DEPP Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP was performed with a Millipore Magna ChIP Kit (Millipore, Darmstadt, Germany) according to the instructions of the manufacturer. Approximately 2 × 107 SH-EP/FOXO3 cells and 20 μl of the protein G beads coupled with 5 μl of anti-FOXO3 antibody (Santa Cruz, Dallas, USA) were used for each preparation. For quantification of FOXO3 binding to the DEPP promoter quantitative real time RT-PCR was performed with primers for the binding sites B1 + B2 (forward AAAACAGCTTGGTGGGCGGG and reverse AACAAGCTTTGGGGCAGGGG) and B3 (forward CTGCTCCTAGGAGAGACACACCCTG and reverse CTGCTACGTTTGCTGTGCTTAGTGC).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!