Dna sequencing

Real-time PCR was carried out using a QuantiNova SYBR Green PCR kit (QIAGEN, Shanghai, China) in accordance with the manufacturer's instructions and by using an initial denaturation step at 95°C for 2 min, followed by 40 cycles with 10 s denaturation at 95°C and 30 s annealing at 60°C. PCR was carried out in an Applied Biosystems 7900 Real-Time PCR system (AB Applied Biosystems, Foster City, CA) by standard melting curve analysis. Negative controls were prepared by adding distilled water instead of the DNA template. The identity of the PCR products was verified by electrophoresis in 2% agarose gels and stained with 1 μl GelRed (Biosharp, Shanghai, China). After assessing molecular weight, each PCR product was purified using the Takara MiniBEST Agarose Gel DNA Extraction Kit v4.0 (Takara, Shiga, Japan), following the manufacturer's protocol, and finally verified by DNA sequencing (Majorbio Company, Shanghai, China).
In all RT-PCR experiments, a 142-bp GAPDH fragment was amplified as a reference housekeeping gene using the intron spanning primers, GAPDH-347 (GCACCGTCAAGGCTGAGAAC) and GAPDH-488 (ATGGTGGTGAAGACGCCAGT). Data were analyzed using the comparative ΔΔCT method, which calculates the difference between threshold cycle (CT) values of the target and reference genes from each sample and then compares the resulting ΔCT values between different samples.

Individual human tRNA sequences were obtained from the Genomic tRNA Database (GtRNAdb), and human miRNA sequences were extracted from miRBase. Plasmids encoding target ncRNAs (Table S1) were cloned as previously reported 28 (link) involving two strategies. Most inserts were obtained through PCR amplification using htRNA-specific primers (Table S2) (IDT, San Diego, CA) and corresponding btRNA^Met-based ncRNA expression plasmids²⁴ as templates. A few other target inserts were directly amplified through PCR reactions with longer primers containing 16-nt complementary sequences (Table S2). The amplicons were thus cloned into pBSTNAV 29 (link) linearized by endonucleases EcoRI-HF® and PstI-HF® (New England Biolabs, Ipswitch, MA) as previously described 28 (link). All clones were propagated in Stellar™ Competent Cells (Takara Bio, Mountain View, CA) and confirmed by DNA sequencing (Genscript, Piscataway, NJ).

Purified RNAs extracted from RdRP reaction mixtures was subjected to RT with M-MLV (Promega) according to the manufacturer’s protocol. The strand-specific oligodeoxynucleotide primers (+)3′RNA1-For (GGAGAAACCC AGCGTGGTGGCATAC) and (−)3′RNA1-Rev (ACTCGGTTCCCTCCACTCTGA GGA), respectively associated with the synthesized plus- and minus-strand RNAs, were used for RT-catalyzed cDNA synthesis, followed by PCR amplification of cDNAs. PCR was performed with (+)3′RNA1-For/(+)3′RNA1-Rev (ACCTCTGCCCTTTCGGGCTAGAACGGGT) or (−)3′RNA1-For (GTTTTCGAA ACAAATAAAACAG)/(−)3′RNA1-Rev primers for amplification of cDNAs. The RT reactions in the absence of any primer were set as controls. Results were detected using UV transillumination after ethidium bromide staining. The cDNAs were then cloned into pMD-18T vector (Takara Bio), followed by DNA sequencing (BioDev-Tech. Co).