Statistical package for the social sciences spss software version 23
The Statistical Package for the Social Sciences (SPSS) software version 23 is a data analysis and statistical software program developed by IBM. SPSS provides a comprehensive set of tools for data management, analysis, and visualization, designed to support research and decision-making in the social sciences and related fields.
Lab products found in correlation
10 protocols using statistical package for the social sciences spss software version 23
Statistical Analysis of Continuous and Categorical Data
Molecular Identification of Cryptococcus Species
In this study, polymerase chain reaction (PCR)restriction fragment length polymorphism (RFLP) was used to distinguish C. neoformans and C. gattii species. The URA5 gene was amplified by PCR using the primers URA5 (5' ATGTCCTCCCAAGCCCTCGACTCCG 3') and SJ01 (5' TTAAGACCTCTGAACACCGTACTC 3'). The amplified PCR product was double digested using the HhaI and Sau96I enzymes, as previously described 3 . The RFLP profiles were visually analyzed by comparison with reference strains.
The data were analyzed using the Statistical Package for the Social Sciences (SPSS) software version 23.0 (IBM Corporation, Armonk, NY, USA). Normality was assessed using the Shapiro-Wilk test. The groups were compared using Student's t-test or the Mann-Whitney U test for continuous variables and Pearson's chi-square test or Fisher's exact test for categorical variables. A significance level of 0.05 was adopted.
Social Media Usage and Medical Information Seeking
All analyses were performed using the Statistical Package for the Social Sciences “SPSS” software version 23 (IBM Corp., Armonk, N.Y., USA). The level of significance equal to .05 was used for all statistical tests.
Statistical Analysis of PK Parameters
Characteristics and Publication Patterns of Clinical Trials
Analyzing Prescription Patterns Using SPSS
HERV-H Expression and ADHD Treatment
Epidemiological Analysis of Conjunctival Squamous Cell Carcinoma
Predicting Cricket Performance from Eye Movements
Exploring Genetic Counseling Perceptions
Respondents were asked one open-ended question on the topic, and the free text answers were separated according to professional group in Excel (Microsoft). Thematic analysis [20 (link)] was used to interpret the free text comments and identify themes relating to the inclusion of NSHL in RGCS. Coding and analysis were checked by LF, MD, and EK until consensus was reached.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!