The largest database of trusted experimental protocols

I bet762

Manufactured by Merck Group
Sourced in United States

I-BET762 is a laboratory tool used for epigenetic research. It functions as a bromodomain and extraterminal (BET) protein inhibitor. The core function of I-BET762 is to selectively bind to bromodomains, which are protein domains that recognize acetylated lysine residues on histones. This interaction can be used to study the role of BET proteins in various biological processes.

Automatically generated - may contain errors

10 protocols using i bet762

1

Characterization of ATC Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
FRO (purchased from the European Collection of Cell Cultures, Salisbury, United Kingdom) and SW1736 (obtained from Cell Lines Service GmbH, Eppelheim, Germany) are human cell lines derived from ATC, both harboring a BRAF V600E mutation (Pilli et al. 2009 (link); Schweppe et al. 2008 (link)). Both cell lines have been tested for being mycoplasma-free and authenticated by STR analysis to be appropriate cell lines of thyroid cancer origin. FRO and SW1736 were grown in DMEM medium (EuroClone, Milan, Italy) and RPMI 1640 medium (EuroClone) respectively, supplemented with 10% fetal bovine serum (Gibco Invitrogen, Milan, Italy), 2 mM L-glutamine (EuroClone) and 50 mg/ml gentamicin (Gibco Invitrogen), in a humidified incubator (5% CO2 in air at 37°C). Cultured cells were treated with vehicle (DMSO, Sigma Aldrich, Saint Louis, MO, USA) or the following agents: JQ1 (50 nM–10 μM in DMSO) (Cayman Chemical, Ann Arbor, MI, USA) and I-BET762 (50 nM –10 μM in DMSO) (Merck Millipore, Darmstadt, Germany). T4888M and T3531L are ATC cell lines derived from tumors developed by [Pten, Tp53]thyr−/− mice (Antico Arciuch et al. 2011 (link)). Cells were grown in DMEM supplemented with 10% FBS.
+ Open protocol
+ Expand
2

Isolation and Stimulation of Murine Pulmonary Macrophages

Check if the same lab product or an alternative is used in the 5 most similar protocols
Pulmonary macrophages were isolated from naïve mouse lungs as previous described [15 (link)]. Briefly, cells were mechanically isolated from mouse lung tissues through 70um cell strainers. Macrophages then were purified by gradient centrifugation (Histopaque 1083; Sigma-Aldrich) and seeded at a concentration of 1×106 cells/well in Dulbecco’s Modified Eagle Medium (DMEM) (Sigma-Aldrich) containing 20% fetal bovine serum (FCS). After 3h, all non-adherent cells were removed and >95% of adherent cells were macrophages. Isolated macrophages were then stimulated with PBS or LPS (50ng/ml; Sigma-Aldrich) and IFNγ (1.5μg/ml; Pepro Tech) in the presence of I-BET-762 (10μM; Merck Millipore) or vehicle (20% hydroxyl-β cyclodextrin, 2% DMSO in 0.9% saline) (Sigma, Aldrich) for 12h, then harvested into Trizol for mRNA qualification.
+ Open protocol
+ Expand
3

CRC Cell Lines and Drug Treatments

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human CRC cell lines, including HCT116, HT29, RKO, SW48, Lim1215, and NCI-H508, were purchased from the American Type Culture Collection and cultured in McCoy’s 5A modified media (Invitrogen). SNU-407 was purchased from AddexBio and cultured in RPMI 1640 (Invitrogen). DR5-knockout (KO) HCT116 cells were previously described (26 (link)). DR5-KO RKO cells were generated by CRISPR/Cas9 using a single guide RNA sequence 5’-CGCGGCGACAACGAGCACAA-3’ as described (27 (link)). Cells were authenticated in 2018 by genotyping and analysis of protein expression by western blotting, and routinely checked for Mycoplasma contamination by PCR. All cell lines were maintained at 37°C and 5% CO2 atmosphere. Cell culture media were supplemented with 10% defined FBS (HyClone), 100 units/ml penicillin, and 100 μg/ml streptomycin (Invitrogen). For drug treatment, cells were plated in 12-well plates at 20–30% density 24 hr before treatment. DMSO (Sigma) stocks of JQ1, I-BET151 (Apexbio), OTX015, I-BET762, 5-FU, and oxaliplatin (Sigma) were prepared and diluted in cell culture media before adding to cells.
+ Open protocol
+ Expand
4

Treating Megakaryocytes with Compounds

Check if the same lab product or an alternative is used in the 5 most similar protocols
After maturation, MKs were treated with one of the following compounds, before undergoing live-cell imaging for 24 hours, as described above: Panobinostat (1-10 μM; Selleckchem, Houston, TX, USA), Valproic acid (1-10μM; Sigma-Aldrich, St Louis, MO, USA), OTX015 (1-10μM; Selleckchem), I-BET762 (1-10μM; Sigma-Aldrich), Puromycin (100ng/mL; Sigma-Aldrich), Taxol (10μM; Sigma-Aldrich), or vehicle control (0.1% DMSO). Technical and biological replicates for each condition were performed, as indicated in the corresponding figure legends.
+ Open protocol
+ Expand
5

PDAC Cell Culture and Treatment

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human PDAC cells (HS766T, BxPC-3, and Panc-1) were obtained from ATCC and were cultured according to standard procedures in DMEM (Gibco, Carlsbad, CA, USA) with a high concentration of glucose, 10% FBS (Gibco, Carlsbad, CA, USA), and 1% penicillin/streptomycin (Sigma-Aldrich, St. Louis, MO, USA). Cells were grown in an atmosphere of 5% CO2 at 37 °C. Cells were observed every week using phase contrast microscopy to ensure the logarithmic growth phase. GEM, JQ-1, and I-BET762 were obtained from Sigma-Aldrich (St. Louis, MO, USA).
+ Open protocol
+ Expand
6

Microglial Phagocytosis Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Reagents for reverse transcription (High-Capacity cDNA Reverse Transcription Kit with RNase Inhibitor) and quantitative PCR (Taqman Assays, TaqMan OpenArray Mouse Phagocytosis Panel, and TaqMan Fast Advanced Master Mix), red fluorescent microspheres (FMS), 2.0 μm, Hoechst 33342, CellMask Orange Actin Tracking Stain, CellMask Green Actin Tracking Stain, RPMI were obtained from Thermo Fisher Scientific, Inc. (Waltham, MA, USA). Opti-MEM was from Gibco, negative siRNA control was from Ambion, Lipofectamine was from Thermo Fisher Scientific, Inc., Aβ1–42 and Aβ1–42 HiLyte 488 were from AnaSpec, Inc. (Fremont, CA, USA). JQ1, GSK12101517, IBET-762, OTX-015, PFI-1, Cytochalasin D were obtained from Sigma-Aldrich (St. Louis, MO, USA). Heat-inactivated foetal bovine serum (FBS), Accutase solution, penicillin, streptomycin, L-glutamine, 3-(4,5-dimethyl-2-tiazolilo)-2,5-diphenyl-2H-tetrazolium bromide (MTT), propidium iodide, TRI-reagent, DNase I, dithiothreitol (DTT), anhydrous dimethyl sulfoxide (DMSO), lipopolysaccharide from Escherichia coli O55:B5 (toxicity 3,000,000 U/mg), and all other reagents were obtained from Sigma-Aldrich (St. Louis, MO, USA).
+ Open protocol
+ Expand
7

Cell Line Validation and Experimental Reagents

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cell lines were purchased from Leibniz-Institut DSMZ—Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ) and tested negative for mycoplasma. Low passage stock cell lines were tested for cell identity validation. Rapamycin (prepared in DMSO, final concentration 20 nM), MK-2206 (prepared in DMSO, final concentration 500 nM), BKM120 (prepared in DMSO, final concentration 5 µM), MDV-3100 (prepared in DMSO, final concentration 10 µM), I-BET762 (prepared in DMSO, final concentration 1 uM), and DHT (4,5α-Dihydrotestosterone, dissolved in ethanol, final concentration 10 nM) were purchased from LC laboratories (Rapamycin), ShelleckChem (BKM120, MK-2206), SCBT (MDV-3100), CAYMAN (I-BET762), and Sigma-Aldrich (DHT). Doxycycline was purchased from Sigma and used at 500 ng/mL for over-expression of YFP-PTEN.
shRNAs against GNMT (TRCN0000000326: sh1; TRCN0000000329: sh4) and FOXO1 (TRCN0000039582) were purchased from Sigma and control shRNA sequence is included (CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTG). YFP-PTEN lentiviral constructs were described in [27 (link)].
+ Open protocol
+ Expand
8

Preparation of Epigenetic Inhibitor Stocks

Check if the same lab product or an alternative is used in the 5 most similar protocols
SAHA/Vorinostat, Romidepsin, I-BET762 (all from Sigma-Aldrich, St. Louis, MO), CPI-0610, OTX015, and JQ1 (all from Cayman Chemicals, Ann Arbor, MI) were dissolved in DMSO to stock concentration of 10-50 mM, stored at −20°C. Serial dilutions were freshly made in DMSO for all cellular assays. The final concentration of DMSO in the medium was less than 0.1%, which did not show any effect on cell growth.
+ Open protocol
+ Expand
9

Macrophage-Cementoblast Interaction Study

Check if the same lab product or an alternative is used in the 5 most similar protocols
The macrophage cell line RAW264.7 was purchased from the ATCC, and the OCCM-30 cementoblast [54 (link)] was kindly provided by Prof. M. Somerman (NIH, NIDCR, Bethesda, MD, USA). Briefly, all cells were maintained in DMEM (41965062, Gibco, New York, NY, USA) containing 10% Fetal Bovine Serum (FBS) (10270-106, Gibco) and 1% penicillin/streptomycin (A3160502, Gibco) and incubated in a humidified atmosphere of 5% CO2 at 37 °C. The cells were seeded into 6-well plates (657160, Greiner Bio-One, Kremsmünster, Austria).) at a density of 3 × 104 cells/well until confluence. The cells used were between passages 3 and 7. Mouse adiponectin was purchased from Sino Biological Inc. (Beijing, China) (Cat. No: 50636-M08H) with purity > 95% (determined via SDS-PAGE). Histone acetylation inhibitor I-BET 762 and Piezo 1 inhibitor GSMTX4 were purchased from Sigma-Aldrich (St. Louis, MO, USA) (SML1272, SML-3140).
+ Open protocol
+ Expand
10

Cardiomyocyte Induction from Mouse Embryonic Fibroblasts

Check if the same lab product or an alternative is used in the 5 most similar protocols
This protocol was modified from previous publication [31] . MEFs were seeded at a density of 10,000 cells/cm 2 and let to attach overnight. The next day, virus supernatant containing retrovirus (as described above) was added to the cells for two consecutive days. The day after, media was changed to cardiomyocytes induction media consist of StemPro-34 SFM supplemented with 1% GlutaMAX, 1 X ITS-X (Thermo Fisher), 50 μg/mL ascorbic acid (Sigma), 10 ng/mL FGF2, 50 ng/mL FGF10 and 5 ng/mL VEGF (Miltenyi Biotec). Media was changed every 3-4 days. Compounds or small molecules that were used are DMSO (Sigma), ethanol (Sigma), SB431542 (Tocris), suberanilohydroxamic acid (SAHA) (Sigma), hexamethylene bisacetamide (HMBA) (Sigma), (+)-JQ1, (-)-JQ1, I-BET 762, RVX-208, C646, CBP30, I-CBP112 and human TGF-β1 (Sigma) (all from Cayman Chemical unless specified otherwise). Stock for all small molecules were prepared in DMSO, expect for C646, CBP30 and I-CBP112, where they were prepared in ethanol, unless specified otherwise. Treatment of DMSO and all small molecules were carried out for 14 days, unless specified otherwise.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!