I bet762
I-BET762 is a laboratory tool used for epigenetic research. It functions as a bromodomain and extraterminal (BET) protein inhibitor. The core function of I-BET762 is to selectively bind to bromodomains, which are protein domains that recognize acetylated lysine residues on histones. This interaction can be used to study the role of BET proteins in various biological processes.
Lab products found in correlation
10 protocols using i bet762
Characterization of ATC Cell Lines
Isolation and Stimulation of Murine Pulmonary Macrophages
CRC Cell Lines and Drug Treatments
Treating Megakaryocytes with Compounds
PDAC Cell Culture and Treatment
Microglial Phagocytosis Assay
Cell Line Validation and Experimental Reagents
shRNAs against GNMT (TRCN0000000326: sh1; TRCN0000000329: sh4) and FOXO1 (TRCN0000039582) were purchased from Sigma and control shRNA sequence is included (CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTG). YFP-PTEN lentiviral constructs were described in [27 (link)].
Preparation of Epigenetic Inhibitor Stocks
Macrophage-Cementoblast Interaction Study
Cardiomyocyte Induction from Mouse Embryonic Fibroblasts
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!