Stem-loop real-time RT-PCR was carried out to analyze miRNA expression. U6 RNA was used as a miRNA internal control. Briefly, extracted RNAs were converted into cDNAs with stem-loop reverse transcription primers (miR-145-5p, 5'- CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAG
Maxima sybr green qpcr master mixes
Maxima SYBR Green qPCR Master Mixes are reagent mixes designed for real-time quantitative PCR (qPCR) experiments. The mixes contain SYBR Green I dye, Maxima Hot Start Taq DNA Polymerase, and necessary PCR components for amplification and detection of target DNA sequences.
Lab products found in correlation
23 protocols using maxima sybr green qpcr master mixes
Quantifying mRNA and miRNA Expression
Stem-loop real-time RT-PCR was carried out to analyze miRNA expression. U6 RNA was used as a miRNA internal control. Briefly, extracted RNAs were converted into cDNAs with stem-loop reverse transcription primers (miR-145-5p, 5'- CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAG
Quantitative RT-PCR Analysis of Muscle Genes
Extraction and Quantification of lncRNAs
RNA Extraction and Real-Time qPCR Protocol
Quantitative Gene Expression Analysis
Total RNA Extraction and qRT-PCR Analysis
Quantifying Gene Expression via RT-qPCR
Arg1 Gene Expression Analysis
Quantifying RNA expression by qPCR
Quantifying Gene Expression via RT-qPCR
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!