Rneasy purification reagent

Real‐time PCR was performed for quantitative gene expression of (PPAR α, SREBP1, LC3, ACC1& sirt1) using RNeasy purification reagent (Qiagen, Valencia, CA), reverse transcription reaction (Superscript II, Gibco Life Technologies, Grand Island, NY, USA) and Applied Biosystems with software version 3.1 (StepOneTM, USA). The primers used are shown in Table 1 (Dawood et al. 2018)
Detection of AMPK protein using Western Blot technique (using V3 Western Workflow™ Complete System, Bio‐Rad® Hercules, CA) and antibodies for AMPK and beta‐actin were supplied by Thermoscientific (Rockford, Illinois, USA) (Elattar et al. 2017)

Tissue samples of the studied groups were lysed and total RNA was isolated with RNeasy purification reagent (Qiagen, Valencia, CA). The purity of total RNA was measured with a spectrophotometer and the wavelength absorption ratio (260/280 nm) was between 1.8 and 2.0 for all preparations. Reverse transcription of total RNA to cDNA was carried out with a reverse transcription reaction (Superscript II, Gibco Life Technologies, Grand Island, NY, USA). Real-time PCR amplification and analysis were carried out using an Applied Biosystem with software version 3.1 (Step One, TM, USA). The reaction contained SYBR Green Master Mix (Applied Biosystems). The data were analyzed with the comparative cycle threshold (CT) method. The expression of β-actin mRNA was used as an internal control in all samples. The primers used were shown in Table 1.Table 1

Primer sequences of studied genes

Gene	Sequence
Endothelin B receptor	Forward primer: 5′ -GATACGACAACTTCCGCTCCA- 3′ Reverse primer:5′ -GTCCACGATGAGGACAATGAG - 3’
Beta actin	Forward primer: 5’ - GACGGCCAGGTCATCACTAT − 3′ Reverse primer: 5′ - CTTCTGCATCCTGTCAGCAA − 3’

Determination of pulmonary surfactant in lung tissue was performed using Rat Pulmonary Surfactant-Associated Protein D (SP-D) ELISA Kit, supplied by MyBioSource, USA, according to the method provided by the manufacturer.

RNA was isolated from cardiac-tissue homogenates of rats in each group using the RNeasy Purification Reagent (Qiagen, Hilden, Germany). RNA purity was assessed using a spectrophotometer, ensuring a 260/280 nm absorption ratio of 1.8–2.0 for all samples. Subsequently, cDNA synthesis was performed employing Superscript II (Gibco Life Technologies, Waltham, MA, USA). Quantitative PCR (qPCR) was performed on a StepOneTM instrument with software version 3.1 (Applied Biosystems, Foster City, CA, USA). Reaction mixtures contained SYBR Green Master Mix (Applied Biosystems, Foster City, CA, USA), gene-specific primer pairs (detailed in Table 1), cDNA, and nuclease-free water. Cycling conditions comprised an initial denaturation step at 95 °C for 10 min, followed by 40 cycles of 15 s at 95 °C and 60 s at 60 °C. Data analysis was conducted using the ABI Prism sequence detection system software, and quantification was performed with the Sequence Detection Software v1.7 (PE Biosystems, Foster City, CA, USA). The comparative cycle threshold method (Livak & Schmittgen, 2001 (link)) was used to determine relative expression levels of the target gene, with all values normalized to β-actin mRNA.

Real-Time-Polymerase Chain Reaction (RT-PCR) was used for determination of SMAD4 and α-SMA gene expression. Total RNA was isolated from liver tissues by using the RNeasy Purification Reagent (Qiagen, Valencia, CA, USA). The list of used primers for SMAD4 and α-SMA were showed in Table 1. Real time quantitative PCR was used to determine gene expression according to the instructions for Applied Bio systems version 3.1 software and SYBR Green I (Step One™, USA). β-actin gene was used as a housekeeping gene and an internal reference control and all data are expressed relative to it.

After the homogenization of the aortic samples, total RNA containing miRNA was determined utilizing TRIzol^® (Invitrogen; Thermo Fisher Scientific Inc.) and extracted. Then, the RNeasy purification reagent (obtained from Qiagen, Valencia, CA) was utilized for RNA isolation, and the purity of the extracted RNA was detected by using a spectrophotometer. Reverse transcription of the extracted RNA to a complementary DNA was performed using the reverse transcription reaction (SuperScript II; Gibco Life Technologies, Grand Island, NY). Real-time PCR amplification and analysis were performed by using SYBR Green PCR core reagents (Applied Biosystems, Foster City, CA, United States) and 0.2 μM of specific primers for rat MALAT1. The expression of β-actin messenger RNA was used as an internal control housekeeping gene in all the samples. The primer sequences of the studied genes are as follows: MALAT1 Forward: 5′-AAA​GCA​AGG​TCT​CCC​CAC​A-3′, Reverse: 5′-TGT​GGG​GAG​ACC​TTG​CTT​T-3′, accession no. LC685074.2, and β-actin (ACTB) Forward: 5′-AGC​CAT​GTA​CGT​AGC​CAT-3′, Reverse: 5′-ATG​GCT​ACG​TAC​ATG​GCT-3′, accession no. NM_031144.2.