Taqman multiscribe reverse transcriptase

Total RNA was extracted from BMMs at the indicated time points after 100 ng·mL⁻¹ RANKL treatment using ISOGEN (Nippon Gene, Tokyo, Japan). First‐stand cDNA was synthesized using TaqMan Multiscribe Reverse Transcriptase (Applied Biosystems, Foster City, CA, USA) and subjected to amplification using Ex Taq polymerase (TaKaRa, Tokyo, Japan) and the following specific PCR primers: 5′‐CAGAGGCTTTTGGCTTCAAC‐3′ and 5′‐CAGACACAGTGAAGGAGGCA‐3′ for Zip14; 5′‐ACTCCTGGGATCAACGTGAC‐3′ and 5′‐GATAGCACATAGGGGGCAGA‐3′ for Oscar; 5′‐TCTCTGCCCATAACCTGGAG‐3′ and 5′‐TACAACTTTCATCCTGGCCC‐3′ for Ctsk; and 5′‐AACTGGGACGACATGGAGAA‐3′ and 5′‐GGGGTGTTGAAGGTCTAAA‐3′ for Gapdh. The PCR conditions are available upon request.

To quantify PD-L1 mRNA expression, total RNA was isolated and cDNA was synthesized using TaqMan MultiScribe Reverse Transcriptase (Applied Biosystems, FosterCity, CA) as previously described [51 (link)]. Quantitative real-time PCR analysis was performed using an ABI Prism 7900-HT Sequence Detection System (96-well, AppliedBiosystems) and Semi-quantitative PCR was performed using Bio-Rad MyCycler PCR System. Primers for this study included: forward primer 5#-CCTACTGGCATTTGCTGAACGCAT-3# and reverse primer 5#-ACCATAGCTGATCATGCAGCGGTA -3# for PD-L1; forward primer 5#-CTCTTGGCTGTTACTGCCAGG-3# and reverse primer 5#-CTCCACACTCTTTTGGATGCT-3# for IFN-γ. Primers used for β-actin were previously reported [51 (link)]. The total semi-quantitative PCR product was then run on a 2% agarose gel.

The hsa-miR-21-5p expression was studied by using the TaqMan microRNA assay kit which included the 5x primer and 20x TaqMan probe for the detection (Assay ID# 000397, ABI). The cDNA was prepared by using MultiScribe TaqMan Reverse Transcriptase (#4366596; Applied Biosystems) and 5x primer following the manufacturer’s protocol. The 20x TaqMan probe and the TaqMan Universal PCR master mix (#4324018; Applied Biosystems) was used to detect the microRNA expression levels. The miRNA expression was normalized to the expression levels of RNU6b.

miRNeasy kit (#217004; Qiagen) was used for miRNA isolation from harvested cells. Multiscribe TaqMan reverse transcriptase (#4366596; Applied Biosystems) was used to make cDNA with miR-432 specific primers. Real time PCR (ABI VII A7 RT-PCR) was done by using miR-432 specific TaqMan probe (# 4427975, Ambion) and universal PCR master mix (#4324018; Applied Biosystems). The expression of miR-432 was normalized by RNU24 expression as endogenous control.
To estimate the viral RNA, total RNA was extracted from cells by using RNeasy mini kit (#74106, Qiagen) according to manufacturer’s protocol. cDNA was synthesized by using superscript II (#11904-018, Invitrogen) according to manufacturer’s protocol. Viral RNA was isolated from culture supernatant by using High pure viral RNA kit (#11858882001, Roche). The primers used in this study have been mentioned in the Table 1. To extract the RNA from mice brain tissue, the tissue was homogenized and RNA was extracted using miRNeasy kit (# 217004; Qiagen). cDNA was synthesized and miR-432 levels were determined by real time PCR. RNU-6 was used as normalization control.

The Qiagen miRNeasy kit (#217004; Qiagen, Venlo, Netherlands) was used for the isolation of total RNA from the microglial cells harvested at different time points. The complementary DNA (cDNA) was prepared by using Superscript II reverse transcriptase system (#11904-018, Invitrogen, CS, USA) using the manufacturer's protocol. The thermal cycles for synthesizing cDNA were: 65°C-5 min, 25°C-10 min, 42°C-50 min, and 70°C-10 min, then, RNase H treatment-20 min at 37°C. The JEV infection in the human microglial cells was confirmed by q-PCR against the JEV NS3 gene, normalized to GAPDH by using Agilent Brilliant III ultrafast SYBR green master mix (#600882, Agilent Technologies, California, US) (Table 1).
To study the microRNA expression, the cDNA was synthesized by using MultiScribe TaqMan Reverse Transcriptase (#4366596; Applied Biosystems, Waltham, MA, USA) along with hsa-miR-374b-5p specific primers according to manufacturer's protocol. The microRNA expression was analyzed using a real time PCR machine (Agilent AriaMx) by using a hsa-miR-374b-5p-specific TaqMan probe and universal PCR master mix (#4324018; Applied Biosystems). The expression of hsa-miR-374b-5p was normalized by endogenous control RNU6b expression.