Ab7254

Between 3000 and 4500 day-1 adults were used in each independent biological sample. Animals were synchronized by L1 arrest except in ash-2 knockdown experiments, in which 500 animals were synchronized at the L4 stage by gonad developmental morphology. Animals were collected by washing plates with M9 buffer at least three times. After removal of the M9 buffer in the last wash, the worm pellet was resuspended in lysis buffer [supplemented with protease and phosphatase inhibitors (Roche)] and sonicated at 30% for 13 s. The samples were then centrifuged at maximum velocity in Eppendorf tubes, and supernatant was collected for Bicinchoninic acid (BCA) protein quantifications. Equal amounts of protein were eluted in 2× sample buffer, boiled to 95°C, centrifuged at maximum velocity, and loaded into NuPAGE Novex bis-tris 10% gels. Antibodies used were ubiquitin (1:500; Abcam, ab7254), glyceraldehyde-3-phosphate dehydrogenase (1:500; Bethyl Laboratories, A303-878A), and GFP (1:500; Sigma-Aldrich, SAB4301138). All immunoblots are representative of at least two independent biological samples, and average of their quantifications is shown under the blot images. The quantification and statistics are shown in bar charts under the blot images, where three or four biological replicates were obtained.

Thermo Scientific Pierce Magnetic RNA-Protein Pull-Down Kits (ThermoFisher, Waltham, MA, USA) were used for the RNA pull-down assay. Briefly, total RNA was extracted from SMMC-7721 and Hep3B cells, and magnetic beads were incubated with probes for biotin-labeled RP11-40C6.2 (Genescript Co., Nanjing, China) (sequence: ACAGGCTGATGCATGGGATTCT) and U6 control (sequence: TTGGAACGATACAGAGAAGATT). For in vitro ubiquitination detection, whole cell lysates were obtained using a lysis buffer containing 10 mM N-Ethylmaleimide. YAP1 was immunoprecipitated and anti-ubiquitin antibody (1:1,000, ab7254; Abcam, Cambridge, UK) was used to detect ubiquitination. To examine the interaction of TAZ with HBx or HBc, Hep3B cells were transduced with HBx or HBc. Cellular TAZ was immunoprecipitated with its antibody (ab652; Abcam) using Dynabead Protein A Immunoprecipitation Kits (ThermoFisher). The presence of HBx and HBc in the immune complex was assayed by western blotting and anti-HBx (ab203540; Abcam) or anti-HBc antibodies (ab8637; Abcam).

The full‐length coding sequences of GW9 and GW2 were cloned into the PET28a and pGEX‐4T‐1 to generate GW9‐His and GW2‐GST vector, respectively. These constructs were transformed into E. coli ArcticExpress (DE3) pRARE2 competent cell, and the recombinant proteins were induced with 0.2 mM IPTG at 18 °C for 16 h. Fusion proteins were purified using the His Resin (TransGen, DP101) or GST Resin (Sangon, C600327‐0001) according to the manufacturer's protocols. The ubiquitination assay in vitro was performed using a Ubiquitinylation Kit (Enzo Life Sciences, BMLUW9920‐0001) according to the manufacturer's instructions and the UbcH5b in the kit was used as E2 enzyme in this study. Polyubiquitinated proteins were detected by immunoblotting with anti‐His (Abmart, M30111M, 1:5000), anti‐GST (Abmart, M20007M, 1:5000), and anti‐ubiquitin (Abcam, ab7254, 1:2000) antibodies, respectively. The primers used are listed in Table S2.