Maxwell extractor

Manufactured by Promega

Sourced in United States

The Maxwell extractor is a laboratory instrument designed to automate the process of nucleic acid extraction. It utilizes magnetic bead-based technology to efficiently capture, wash, and elute DNA or RNA samples from a variety of sample types, such as cells, tissues, or bodily fluids. The Maxwell extractor streamlines the extraction workflow, providing consistent and reliable results.

Automatically generated - may contain errors

Lab products found in correlation

Tempus, by Thermo Fisher Scientific (2 mentions) Maxwell 16 lev blood rna kit, by Promega (2 mentions) Ncounter analysis technology, by NanoString (2 mentions) Paxgene, by BD (2 mentions) Rneasy plus micro kit, by Qiagen (2 mentions) Taqman fast virus 1 step master mix, by Thermo Fisher Scientific (1 mentions)

3 protocols using maxwell extractor

Transcriptome Analysis of COVID-19 Patients

Check if the same lab product or an alternative is used in the 5 most similar protocols

Whole blood was collected into PAXgene (BD Biosciences) or Tempus (Thermo Fisher Scientific) blood RNA tubes or EDTA tubes. RNA was extracted with the corresponding RNA extraction kits or with the Maxwell 16 LEV Blood RNA kit and a Maxwell extractor (Promega) and quantified by spectrometry (Nanovue). For P5, RNA was extracted from sorted T cells with the RNeasy Plus microkit (Qiagen). Relative expression levels were determined for TRBV 11–2 with nCounter analysis technology (NanoString Technologies), by calculating TRBV 11–2 mRNA levels relative to other TRBV mRNA levels and normalizing against the median value for the healthy volunteer group. Blood samples from P1, P2, and P5 were obtained on days 7, 4, and 9 after symptom onset, respectively.

Boyce F.M., Beggs A.H., Feener C, & Kunkel L.M. (1991). Dystrophin is transcribed in brain from a distant upstream promoter.. Proceedings of the National Academy of Sciences of the United States of America, 88(4), 1276-1280.

+ Open protocol

+ Expand

Transcriptome Analysis of COVID-19 Patients

Check if the same lab product or an alternative is used in the 5 most similar protocols

Lee D., Pen J.L., Yatim A., Dong B., Aquino Y., Ogishi M., Pescarmona R., Talouarn E., Rinchai D., Zhang P., Perret M., Liu Z., Jordan I., Bozdemir S.E., Bayhan G.I., Beaufils C., Bizien L., Bisiaux A., Lei W., Hasan M., Chen J., Gaughan C., Asthana A., Libri V., Luna J.M., Jaffré F., Hoffmann H.H., Michailidis E., Moreews M., Seeleuthner Y., Bilguvar K., Mane S., Flores C., Zhang Y., Arias A.A., Bailey R., Schlüter A., Milisavljevic B., Bigio B., Voyer T.L., Materna M., Gervais A., Moncada-Velez M., Pala F., Lazarov T., Levy R., Neehus A.L., Rosain J., Peel J., Chan Y.H., Morin M.P., Pino-Ramirez R.M., Belkaya S., Lorenzo L., Anton J., Delafontaine S., Toubiana J., Bajolle F., Fumadó V., DeDiego M.L., Fidouh N., Rozenberg F., Pérez-Tur J., Chen S., Evans T., Geissmann F., Lebon P., Weiss S.R., Bonnet D., Duval X., Pan-Hammarström Q., Planas A.M., Meyts I., Haerynck F., Pujol A., Sancho-Shimizu V., Dalgard C.L., Bustamante J., Puel A., Boisson-Dupuis S., Boisson B., Maniatis T., Zhang Q., Bastard P., Notarangelo L., Béziat V., de Diego R.P., Rodriguez-Gallego C., Su H.C., Lifton R.P., Jouanguy E., Cobat A., Alsina L., Keles S., Haddad E., Abel L., Belot A., Quintana-Murci L., Rice C.M., Silverman R.H., Zhang S.Y, & Casanova J.L. (2023). Inborn errors of OAS–RNase L in SARS-CoV-2–related multisystem inflammatory syndrome in children. Science (New York, N.Y.), 379(6632), eabo3627.

+ Open protocol

+ Expand

SARS-CoV-2 Detection from FFPE Tissue

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total nucleic acid was extracted from FFPE tissues using the Maxwell RSC DNA FFPE Kit (reference: AS1450. Promega Corporation, Madison, WI, USA) and the Promega Maxwell extractor, following the protocol described by the manufacturer. One-step RT-PCR assays specific for the amplification of SARS-CoV-2 E envelope protein gene were adapted from a published protocol [12 ]. Briefly, 4 μL of RNA (100 ng) was amplified in 20 μL reaction mixture containing 5 μL of TaqMan Fast Virus 1-step master mix (Life Technologies), 0.4 μM of each forward (ACAGGTACGTTAATAGTTAATAGCGT) and reverse (ATATTGCAGCAGTACGCACACA) primers and 0.2 μM of probe (FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ). The amplification condition was 50 °C for 10 min for reverse transcription, followed by 95 °C for 20 s and then 45 cycles of 95 °C for 3 s and 58 °C for 30 s. A clinical sample highly positive for SARS-CoV-2 was diluted 1:1000 and used as a positive control in each analysis. A clinical sample obtained from a patient who was autopsied before the COVID-19 pandemic was used as a negative control. The quality of the RNA from the samples showing negative results was assessed by amplification of the human MET RNA according to a validated ISO:15189 accredited method used as a routine diagnostic method in our laboratory.

Remmelink M., De Mendonça R., D’Haene N., De Clercq S., Verocq C., Lebrun L., Lavis P., Racu M.L., Trépant A.L., Maris C., Rorive S., Goffard J.C., De Witte O., Peluso L., Vincent J.L., Decaestecker C., Taccone F.S, & Salmon I. (2020). Unspecific post-mortem findings despite multiorgan viral spread in COVID-19 patients. Critical Care, 24, 495.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!