To detect B19V DNA in the serum of patients with hemophilia, a sensitive real-time PCR test was used to amplify a 154-base pair (bp) fragment of the NS1 gene. The primer and hydrolysis probe were as follows: B1F (5′-CCACTATGAAAACTGGGCAATA-3′), B1R (5′-GCTGCTTTCACTGAGTTCTTCA-3′) and probe 5′-FAM-AATGCAGATGCCCTCCACCCAG-TAMRA-3′ [20 (link)]. The reaction mixture contained 7.5 µL of 2X qPCR master mix for probe (Yekta Tajhiz Azma, Iran), 0.5 µM each of forward and reverse primers, 0.2 µM probe, and 3 µL of template and nuclease-free water in a reaction volume of 15 µL. The amplification cycle was conducted using a QIAGEN real-time PCR cycler (Rotor-Gene Q 2plex Platform, QIAGEN GmbH, Germany) with a two-step method, including a 95℃ hold for 10 min and then 35 cycles of 95℃ for 20 sec and 62℃ for 30 sec.
Rotor gene q 2plex platform
Manufactured by Qiagen
Sourced in Germany
The Rotor-Gene Q 2plex Platform is a real-time PCR cycler designed for precise and reliable nucleic acid amplification. It features a 2-plex detection system and can perform various real-time PCR applications.
Automatically generated - may contain errors
Lab products found in correlation
3 protocols using rotor gene q 2plex platform
1
Real-Time PCR for B19V DNA Detection
2
qRT-PCR for Limb Regeneration
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
qRT-PCR was conducted on selected genes during the limb regeneration process with the ribosomal S27 fusion protein (S27) used as the reference gene for normalization (table S22). We conducted qRT-PCR using SYBR Premix Ex Taq (Takara) on a Rotor-Gene Q 2plex Platform (Qiagen, Germany). For each selected gene, four to six biological replicates were performed. Gene expression levels were measured using the 2−ΔΔCt method.
3
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primer sequences
used in the qPCR
are reported as follows: 18S rRNA gene forward CCCAGTGAGAATGCCCTCTA,
reverse TGGCTGAGCAAGGTGTTATG; COL3α1 gene forward
CTGGTGCTAATGGTGCTCCT, reverse TCTCCTTTGGCACCATTCTT. Synthesized cDNA
was amplified using an SYBR Green JumpStart Taq ReadyMix master mix,
and qPCRs were performed on a Rotor-Gene Q 2plex Platform (Qiagen).
All qPCR reactions were performed in duplicate. PCR cycle conditions
were set as follows: initial denaturation at 94 °C for 2 min
followed by 40 cycles of 94 °C for 15 s and 60 °C for 15
s. At the end of the program, the temperature was reduced to 60 °C
and then gradually increased by 1 °C increments up to 95 °C
to produce a melt curve. Gene expression was normalized to the 18S
rRNA gene expression levels using the threshold cycle (Ct) –
relative quantification method (2–ΔΔCt). The Ct values of the 18S gene did not change between the control
and treated samples. Data are presented as a fold change compared
to unstimulated cells. In all reactions, a standard curve including
five dilutions of known cDNA was generated to ensure highly efficient
product amplification. R2 of all reactions
was 0.98–0.99.
used in the qPCR
are reported as follows: 18S rRNA gene forward CCCAGTGAGAATGCCCTCTA,
reverse TGGCTGAGCAAGGTGTTATG; COL3α1 gene forward
CTGGTGCTAATGGTGCTCCT, reverse TCTCCTTTGGCACCATTCTT. Synthesized cDNA
was amplified using an SYBR Green JumpStart Taq ReadyMix master mix,
and qPCRs were performed on a Rotor-Gene Q 2plex Platform (Qiagen).
All qPCR reactions were performed in duplicate. PCR cycle conditions
were set as follows: initial denaturation at 94 °C for 2 min
followed by 40 cycles of 94 °C for 15 s and 60 °C for 15
s. At the end of the program, the temperature was reduced to 60 °C
and then gradually increased by 1 °C increments up to 95 °C
to produce a melt curve. Gene expression was normalized to the 18S
rRNA gene expression levels using the threshold cycle (Ct) –
relative quantification method (2–ΔΔCt). The Ct values of the 18S gene did not change between the control
and treated samples. Data are presented as a fold change compared
to unstimulated cells. In all reactions, a standard curve including
five dilutions of known cDNA was generated to ensure highly efficient
product amplification. R2 of all reactions
was 0.98–0.99.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!