Taqman gene specific probes

Manufactured by Thermo Fisher Scientific

Sourced in United States

TaqMan gene specific probes are fluorescent oligonucleotide probes designed for quantitative real-time PCR. They contain a reporter dye at the 5' end and a quencher dye at the 3' end. During PCR, the probe anneals to a specific target sequence and is cleaved by the 5' exonuclease activity of Taq DNA polymerase, which separates the reporter dye from the quencher dye, resulting in an increase in fluorescent signal.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

Taqman probes for specific genes Universal TaqMan master mix and primer/probe sets specific for the genes Specific TaqMan probes Gene-specific probes TaqMan gene probes TaqMan probes

8 protocols using taqman gene specific probes

LRIG1 mRNA Expression in Breast Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols

The publicly available Oncomine database (www.oncomine.org) was used to assess LRIG1 mRNA expression in the Neve dataset of 51 breast cancer cell lines (31 (link)). Breast cancer cell lines were sorted by gene cluster and the log expression of LRIG1 was compared. This database was also used to assess LRIG1 mRNA expression in the Curtis, Hatzis and Gluck datasets (not shown). Tumors were sorted by PAM50 molecular subtype into Normal, Basal-like, Her2, Luminal A and Luminal B and the log expression of LRIG1 was compared. The Breast Cancer Gene-Expression Miner Version 3.0 was also used to assess LRIG1 mRNA expression (32 (link)). The prognostic gene expression analysis tool was used with analysis by molecular subtype and RSSPC robust classification.
For real-time PCR (qPCR) analysis of LRIG1 expression in cell lines, RNA was isolated from cells using PureLink RNA Mini Kit (Life Technologies) according to manufacturer’s protocol. The High-Capacity cDNA reverse transcription kit (Applied Biosystems) was used to make cDNA, and qPCR was performed in a Bio-Rad iCycler CFX-96 using SsoAdvanced Universal Probes Supermix (Bio-Rad) and TaqMan gene specific probes (Applied Biosystems). Relative LRIG1 mRNA levels (probe: Hs00394267_m1) were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) levels for each sample. Data are presented as mean ± SEM, n=3.

Yokdang N., Hatakeyama J., Wald J.H., Simion C., Tellez J.D., Chang D.Z., Swamynathan M.M., Chen M., Murphy W.J., Carraway KL I.I.I, & Sweeney C. (2015). LRIG1 opposes epithelial to mesenchymal transition and inhibits invasion of basal-like breast cancer cells. Oncogene, 35(22), 2932-2947.

+ Open protocol

+ Expand

Rat Hippocampal Total RNA Extraction and Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from rat hippocampus (n = 4, for each time and treatment evaluated) with TRIzol^® reagent, considering the supplier’s protocol (Invitrogen Corporation, Carlsbad, CA, USA, cat. no.15596026). cDNA was synthesized from 500 ng of total RNA using AMPIGENE^® cDNA Synthesis kit (Enzo Life Sciences, ENZ-KIT106). The reverse-transcribed product was diluted five times and 2.0 μL of cDNA was mixed with 2× TaqMan Master Mix and 0.5 µL of 20× Gene Expression Assay, the reaction was conducted in 7500 Fast Real-Time PCR system (Applied Biosystems, Foster City, CA, USA). The TaqMan^® gene-specific probes (Applied Biosystems, Foster City, CA, USA) selected in this work were IL-6 (cat. no. Rn01410330_m1) and β-actin (cat. no. Rn00667869_m1). The 2^−ΔΔCt method was used to analyze the relative target gene expression respect the β-actin gene expression [86 (link)].

Toral-Rios D., Patiño-López G., Gómez-Lira G., Gutiérrez R., Becerril-Pérez F., Rosales-Córdova A., León-Contreras J.C., Hernández-Pando R., León-Rivera I., Soto-Cruz I., Florán-Garduño B, & Campos-Peña V. (2020). Activation of STAT3 Regulates Reactive Astrogliosis and Neuronal Death Induced by AβO Neurotoxicity. International Journal of Molecular Sciences, 21(20), 7458.

+ Open protocol

+ Expand

LRIG1 mRNA Expression in Breast Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols

+ Open protocol

+ Expand

RNA isolation, cDNA synthesis, and RT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated using the Purelink RNA Mini kit from Life Technologies (Carlsbad, CA) according to the manufacturer’s protocol. The RNA was then reverse transcribed to cDNA using the High-Capacity cDNA Reverse Transcription kit from Applied Biosystems (Grand Island, NY) according to the manufacturer’s protocol. The RT-PCR was performed using Taqman gene-specific probes (Applied Biosystems) with Taqman Fast Universal Master Mix (Life Technologies) according to the published protocol using the Viia7 RT-PCR machine (Applied Biosystems). The GAPDH RNA expression was used to normalize the WIF1 levels.

Reno T.A., Tong S.W., Wu J., Fidler J.M., Nelson R., Kim J.Y, & Raz D.J. (2016). The triptolide derivative MRx102 inhibits Wnt pathway activation and has potent anti-tumor effects in lung cancer. BMC Cancer, 16, 439.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from tumor cell lines was isolated with the RNeasy Mini Kit (Qiagen), according to the manufacturer’s instructions. The cDNA preparation was done according to standard procedures, using M-MLV reverse transcriptase (Promega) and oligo-dT primers (Promega). Gene expression was measured using the following Taqman gene-specific probes from Thermofisher: NRP1 (Hs00826128_m1), EGFR (Hs00193306_m1), and the housekeeping genes GAPDH (Hs04420632_g1) and β-actin (Hs99999903_m1). The expression of the following genes was assessed by means of SYBR-green specific primer pairs: p27/Kip1 (CDKN1B gene) (CTGAGGACACGCATTTGGT, GGGGAACCGTCTGAAACAT), Galectin-1 (LGALS1 gene) (GACTCAATCATGGCTTGTGGTCTG, GCTGATTTCAGTCAAAGGCCACAC); and the housekeeping genes GAPDH (GAAGGTGAAGGTCGGAGTC, GAAGATGGTGATGGGATTTC) and β-actin (CACTCTTCCAGCCTTCCTTC, GTACAGGTCTTTGCGGATGT). Real-time PCR analysis was performed using the 7900HT Fast Real-time PCR System by Applied Biosystems (foster City, CA, USA).

Rizzolio S., Corso S., Giordano S, & Tamagnone L. (2020). Autocrine Signaling of NRP1 Ligand Galectin-1 Elicits Resistance to BRAF-Targeted Therapy in Melanoma Cells. Cancers, 12(8), 2218.

+ Open protocol

+ Expand

RNA Isolation and Gene Expression Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from tumor cell lines or tissues was isolated with the RNeasy Mini Kit (Qiagen, Germantown, MD, USA), according to the manufacturer’s instructions [18 (link)]. cDNA preparation was conducted according to standard procedures, using M-MLV Reverse Transcriptase (Promega, Madison, WI, USA) and oligo-dT primers (Promega, Madison, WI, USA). Gene expression was measured using the following Taqman gene-specific probes from Thermo Fisher Scientific: NRP-1 (Hs00826128_m1), EGFR (Hs00193306m1), and the housekeepers GAPDH (Hs04420632_g1), and

β

-actin (Hs99999903_m1) [19 (link)].

Napolitano V., Russo D., Morra F., Merolla F., Varricchio S., Ilardi G., Di Crescenzo R.M., Martino F., Mascolo M., Celetti A., Tamagnone L, & Staibano S. (2021). Neuropilin-1 Expression Associates with Poor Prognosis in HNSCC and Elicits EGFR Activation upon CDDP-Induced Cytotoxic Stress. Cancers, 13(15), 3822.

+ Open protocol

+ Expand

Quantitative Analysis of PP1 Subunit Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was purified using an RNeasy Kit (QIAGEN) and reverse transcription into cDNA was performed with 3 μg of mRNA using the High-Capacity cDNA Reverse Transcription Kit (Life Technologies) according to the manufacturer's recommendations. Real-time PCR was performed with an Applied Biosystems 7900HT cycler using the GoTaq® Probe qPCR Master Mix (Promega), following the manufacturer's recommendations. The thermocycler parameters were 95°C for 10 min followed by 40 cycles of 95°C for 15 s and 60°C for 60 s. We used the following TaqMan gene-specific probes from Life Technologies: PPP1R9B (Hs00261636_m1), PPP1CA(Hs00267568_m1), PPP1CB (Hs01027793_m1), PPP1CC (Hs00160351_m1), and GAPDH (Hs03929097_g1). We used the housekeeping gene GAPDH to normalize the RNA amount. Relative changes in gene expression levels were calculated using the comparative threshold cycle (ΔΔCt) method. At least three independent experiments were performed for each of the analyzed genes. Student's t-test was applied for each pair of samples, with a significance threshold of p < 0.05.

Verdugo-Sivianes E.M., Navas L., Molina-Pinelo S., Ferrer I., Quintanal-Villalonga A., Peinado J., Garcia-Heredia J.M., Felipe-Abrio B., Muñoz-Galvan S., Marin J.J., Montuenga L., Paz-Ares L, & Carnero A. (2017). Coordinated downregulation of Spinophilin and the catalytic subunits of PP1, PPP1CA/B/C, contributes to a worse prognosis in lung cancer. Oncotarget, 8(62), 105196-105210.

+ Open protocol

+ Expand

Quantitative Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from each cell line using Qiagen RNeasy Mini Kit (Qiagen, Valencia, CA). An on-column DNA digestion was performed during RNA purification using the Qiagen RNase-Free DNase Set (Qiagen, Valencia, CA). RNA quality and quantity was assessed using a Nanodrop spectrophotometer. 1 ug of RNA from each cell line was converted into cDNA using an ABI High-Capacity cDNA Reverse Transcription Kit (Life Technologies, Grand Island, NY). 100 ng of cDNA was used as a template for qRT-PCR in combination with a TaqMan® Gene Expression Master Mix (Life Technologies, Grand Island, NY) and Taqman Gene-specific probes (Assay ID: Ascl1—Rn00574345_m1; 18 S—Rn03928990_g1; S100b—Rn04219408; Rbfox3—Rn01464214_m1) on the StepOnePlus™ Real-Time PCR System (Life Technologies, Grand Island, NY). We assayed a minimum of four biological replicates for each group; cycling reactions were performed in duplicate. The relative expression of each gene was calculated based on the ΔΔCt value, where the results were normalized to the average Ct value of data from the 18 S housekeeping gene. We used Student’s paired t-test with two tails for statistical analysis. Data presented as mean ± SEM.

Lo C.L., Choudhury S.R., Irudayaraj J, & Zhou F.C. (2017). Epigenetic Editing of Ascl1 Gene in Neural Stem Cells by Optogenetics. Scientific Reports, 7, 42047.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!