Eif2ak4

Manufactured by Qiagen

Eif2ak4 is a gene that encodes a protein kinase involved in the regulation of protein synthesis. It plays a role in the cellular response to various stress conditions, such as amino acid deprivation, viral infection, and endoplasmic reticulum stress. The Eif2ak4 protein is responsible for phosphorylating the translation initiation factor eIF2, which leads to a global reduction in protein synthesis as a mechanism to conserve cellular resources during stress.

Automatically generated - may contain errors

Lab products found in correlation

Trizol, by Thermo Fisher Scientific (2 mentions) Sybr green master mix, by Thermo Fisher Scientific (1 mentions) 7900ht thermocycler, by Thermo Fisher Scientific (1 mentions) Verso cdna synthesis kit, by Thermo Fisher Scientific (1 mentions) Tbx21, by Qiagen (1 mentions) Sybr green incorporation, by Thermo Fisher Scientific (1 mentions) Ddit3, by Qiagen (1 mentions)

2 protocols using eif2ak4

Transcriptional Profiling of T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from T cells using TRIzol (Life Technologies). Reverse transcription was performed using the Verso cDNA Synthesis Kit (Thermo Scientific). Quantitative PCR reactions were prepared by using Bio-Rad SYBR green master mix and performed on an Applied Biosystems thermocycler (7900 HT). Primers against murine Ddit3 forward (GGAGCTGGAAGCCTGGTATG) reverse (GGATGTGCGTGTGACCTCTG), Atf4 forward (GCCTGACTCTGCTGCTTA) reverse (GCCTTACGGACCTCTTC), Eif2ak3 forward (ATCGCAGAGGCAGTGGAGTT) reverse (AGGCTGGCATTGGAGTCAGT), and Actb forward (TGTGATGGTGGGAATGGGTCAGAA) reverse (TGTGGTGCCAGATCTTCTCCATGT) were from IDT. Primers for murine Il12b2, Cxcr3, Ifng, Gzmb, Tbx21, Cbfa3, Eif2ak1, Eif2ak2, and Eif2ak4 and human DDIT3 were purchased from QIAGEN. Relative expression was calculated using the ΔΔCt method and normalized to actb levels.

Cao Y., Trillo-Tinoco J., Sierra R.A., Anadon C., Dai W., Mohamed E., Cen L., Costich T.L., Magliocco A., Marchion D., Klar R., Michel S., Jaschinski F., Reich R.R., Mehrotra S., Cubillos-Ruiz J.R., Munn D.H., Conejo-Garcia J.R, & Rodriguez P.C. (2019). ER stress-induced mediator C/EBP homologous protein thwarts effector T cell activity in tumors through T-bet repression. Nature Communications, 10, 1280.

+ Open protocol

+ Expand

Quantifying Stress Response Genes in T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

CD4⁺ or CD8⁺ T cells were purified from MLR using negative selection or by cell sorting. Cells were lysed in Trizol (Invitrogen) for subsequent RNA isolation according to the manufacturer’s protocol. cDNA was synthesized using SuperScript II reverse transcriptase, random and oligo dT primers (Invitrogen). Eif2ak4, Ddit3, Atf4 and Ccr7 primer sets were purchased from Qiagen. SYBR Green incorporation (Applied Biosystems) was measured using an ABI Prisms 7300 thermocycler (Applied Biosystems). All values were normalized to GAPDH mRNA.

Van de Velde L.A., Guo X.Z., Barbaric L., Smith A.M., Oguin TH I.I.I., Thomas P.G, & Murray P.J. (2016). Stress kinase GCN2 controls the proliferative fitness and trafficking of cytotoxic T cells independent of environmental amino acid sensing. Cell reports, 17(9), 2247-2258.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!