Dspe peg2000 folate

Folate-conjugated liposomes were prepared by postinsertion of DSPE-PEG2000-folate micelles into preformed liposomes with slight modifications^{63 (link),64 (link)}. In brief, 1 mg DSPE-PEG2000-folate (Avanti Polar Lipids, no. 880124) was dissolved in 320 µL DMSO, followed by hydration with 3.1 mL of distilled water, producing 100 µM micelle suspension. The suspension was then dialysed three times in a 10000 MWCO dialysis tubing against 1 L water to remove DMSO. After this, 40 µL of micelles were added to 1 mL of the preformed liposome suspension in ammonium sulphate (250 mM) and heated at 60 °C for 1 h to produce folate-tethered liposomes. Leaked ammonium sulphate and unincorporated micelles were removed by dialysis. To determine the folate content conjugated with liposomes, bare liposomes was used in conjugation procedure instead of VP-loaded liposomes. After preparation, the folate amount was determined by measuring the UV absorbance at 285 nm after lysing liposomes with 0.1% Triton X-100 and comparing with a standard curve of folic acid with the known concentration.

LnCl₃·xH₂O (Ln = Y, Yb, Er; x ≈ 5, 99.9%), ammonium fluoride (NH₄F, 96%), 1-octadecylen (ODE) and oleic acid (OA) were purchased from Alfa Aesar Reagent Company. N-hydroxysulfosuccinimide (NHS), 1-ethyl-3-(3-dimethylamino-propyl) carbodiimide (EDC), 9, 10-Anthracenediyl-bis(methylene)dimalonic acid (ABDA), vitamin C, merocyanine 540 (MC540) and DOX were obtained from Sigma Aldrich (USA). DSPE-PEG₂₀₀₀ (1, 2-distearoyl-sn-glycero-3-phosphoethanolamine, DSPE), DSPE-PEG₂₀₀₀-NH₂ and DSPE-PEG₂₀₀₀-Folate were purchased from Avanti Polar Lipids (USA). All other reagents were of analytic grade.
Roswell Park Memorial Institute (RPMI) 1640 Medium, Hoechst, Cy5.5 dye, and CellMask™ Deep Red Plasma membrane Stain were purchased from Life technologies, and Mitochondrion-Selective Probe were supplied by Invitrogen (USA). Cell Counting Kit-8 (CCK-8) was bought from Beyotime (China). B16 cells and BALB/C mice were obtained from the Peaking University Health Science Center (China). All animal experiments were performed in accordance with the principles of care and use of laboratory animals and were approved by the experiment animal administrative committee of Peaking University Health Science Center.

1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-((N(5-amino-1-carboxypentyl)iminodiacetic acid) succinyl)(nickel salt) (NiLipid), and 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[folate(polyethylene glycol)-2000] (ammonium salt) (DSPE-PEG2000-folate) (PF) were purchased from Avanti Polar Lipids (Alabaster, AL). All other reagents were ordered from Sigma-Aldrich (St. Louis, MO). NHS-PEG4-DBCO was purchased from Click Chemistry Tools (Scottsdale, AZ). The cholesterol-modified oligodeoxynucleotide (cODN) (5′–TCAACATCAGTCTGATAAGCTA–tetraethyleneglycol–cholesterol–3′) was purchased from Integrated DNA Technologies (Coralville, IA). The C18-PEG6-N₃ molecule was custom synthesized by Creative PEGworks (Winston Salem, NC). RPMI1640, Opti-MEM, fetal bovine serum, Alexa Fluor 647 NHS Ester (AF647), Alexa Fluor 750 NHS Ester (AF750), Alexa Fluor 488 5-Carboxamido-(6-Azidohexanyl), Bis(Triethylammonium Salt) (AF488-azide), primary antibodies and secondary antibodies were obtained from Invitrogen (Carlsbad, CA). ELISA kits for cytokine analysis were purchased from R&D systems (Minneapolis, MN). The kits for LDH and MTT analysis were purchased from Promega (Madison, WI) and Invitrogen.