ChIP was performed following the protocol reported previously (Kalkan et al., 2019 (link)). Briefly, chromatin was cross-linked with 1% formaldehyde for 10 minutes at RT and quenched with 125 mM Glycine for 5 minutes at RT with rotation. After cell pellets were lysed, sonication was performed for 16 cycles on High setting, 30sec ON/30 sec OFF cycle by Bioruptor (Diagenode), 2x107 cells per 300 μl in Bioruptor tube. 10% inputs were collected for the later library construction. Chromatin was immunoprecipitated with 2 μg of each antibodies and 20 μl of Protein G Dynabeads (Invitrogen) were used against 3x106 cells. After the washes, DNA was eluted and each samples were treated with 2.5 μg/ml RNase A at 37°C for 30 minutes followed by 87.5 μg/ml Proteinase K at 55°C for 1 hour. DNA was purified with PCR clean-up kit (Qiagen). Libraries were prepared by NEXTflex Rapid DNA-Seq Kit 2.0 bundle with 96 HT barcodes (ParkinElmer).
Bioruptor
Manufactured by Diagenode
Sourced in Belgium, United States
The Bioruptor is a laboratory instrument designed for the efficient disruption and homogenization of biological samples. It uses high-intensity ultrasound waves to shear and fragment a wide range of sample types, including cells, tissues, and macromolecules, without the use of bead beating or other mechanical disruption methods. The Bioruptor is a versatile tool for a variety of applications, including DNA/RNA extraction, protein extraction, and chromatin shearing.
Automatically generated - may contain errors
Lab products found in correlation
Qiaquick pcr purification kit, by Qiagen (28 mentions)
Dynabead, by Thermo Fisher Scientific (28 mentions)
Hiseq 2500, by Illumina (23 mentions)
Protein g dynabead, by Thermo Fisher Scientific (23 mentions)
Hiseq 2000, by Illumina (22 mentions)
Pcr purification kit, by Qiagen (21 mentions)
Dynabeads protein g, by Thermo Fisher Scientific (20 mentions)
Pierce bca protein assay kit, by Thermo Fisher Scientific (18 mentions)
Protease inhibitor cocktail, by Roche (17 mentions)
Ez dna methylation gold kit, by Zymo Research (15 mentions)
Formaldehyde, by Merck Group (15 mentions)
Ampure xp bead, by Beckman Coulter (15 mentions)
Qiaquick gel extraction kit, by Qiagen (14 mentions)
2100 bioanalyzer, by Agilent Technologies (14 mentions)
Protease inhibitor cocktail, by Merck Group (13 mentions)
Ab1791, by Abcam (13 mentions)
Dynabeads protein a, by Thermo Fisher Scientific (12 mentions)
Trizol, by Thermo Fisher Scientific (12 mentions)
Agilent 2100 bioanalyzer, by Agilent Technologies (11 mentions)
Nextseq 500, by Illumina (11 mentions)
1 133 protocols using bioruptor
1
ChIP-seq Protocol for Chromatin Profiling
2
ChIP-seq Protocol for Chromatin Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromatin immunoprecipitation (ChIP) was performed as described (Kalkan et al., 2019 (link)). Briefly, chromatin was cross-linked with 1% formaldehyde for 10 minutes at RT and quenched with 125 mM Glycine for 5 minutes at RT with rotation. After cell pellets were lysed, sonication was performed for 16 cycles on High setting, 30sec ON/30 s OFF cycle by Bioruptor (Diagenode), 2x107 cells per 300 μl in Bioruptor tube. 10% inputs were collected for the later library construction. Chromatin was immunoprecipitated with 2 μg of each antibodies and 20 μl of Protein G Dynabeads (Invitrogen) were used against 3x106 cells. After the washes, DNA was eluted and each samples were treated with 2.5 μg/ml RNase A at 37°C for 30 minutes followed by 87.5 μg/ml Proteinase K at 55°C for 1 hour. DNA was purified with PCR clean-up kit (QIAGEN). Libraries were prepared by NEXTflex Rapid DNA-Seq Kit 2.0 bundle with 96 HT barcodes (ParkinElmer).
3
STAT3-mediated Chromatin Immunoprecipitation in C3H10T1/2 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP analysis in C3H10T1/2 cells was performed using an enzymatic chromatin immunoprecipitation kit (MILLIPORE, Catalog #17-371) following the instructions of the manufacturer. Briefly, C3H10T1/2 cells at 80–90% confluence in 10 cm dishes were cross-linked with 1% formaldehyde for 10 min at room temperature followed by quenching with glycine. Chromatin digestion was performed to obtain DNA fragments from 250 to 500 bp by micrococcal nuclease (BioruptorTM, Diagenode, Belgium). Immunoprecipitation was performed with STAT3 (CST, #12640, Rabbit monoclonal, 1:50), and IgG (MILLIPORE, No. 12-371B) was used as a negative control. Precipitated DNA was detected by qPCR with specific primers (Fig. 6a ). Primers for Dlx5 promoter F: TGCCTACTTTTCGGTCTTCA; Dlx5 promoter R: CTCGACTACTTGGAAGCTTC.
4
UV-Crosslinking and Immunoprecipitation of PTB
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The day before collection, 10 7 cells were seeded per condition and IP reaction (5x10 6 for PTB and 5x10 6 for normal mouse IgG1 IP s) in a p15 plate. Next, day, cell media was discarded and each plate was washed with 12 ml of cold PBS 1X (D8537, Sigma-Aldrich). Cells were UV-crosslinked at 254 nm with 2000 J/m 2 in ice and scrapped. After centrifugation at 2500 rpm for 5 min, the PBS was discarded and the pellets were stored at -80 °C until processing. Cells were lysed in 617.5 l of cell lysis buffer (1% v/v NP-40, 400 U/ml of RNAse inhibitor in 1x PBS) for 10 min in ice. Sodium deoxycholate was added to 0.5% v/v final concentration and samples were incubated with rotation for 15 min at 4°C. Samples were incubated at 37 °C with 30 U of DNAse with shacking at 300 rpm, vortexed briefly and sonicated for 10 cycles x (30 on /30 off, high setting condition) in 15 ml conical polystyrene tubes using a Bioruptor TM (Diagenode) sonicator with a 4°C water bath cold circulation system. After that, the tubes were spun to recover all sample and centrifuged for 15 min at 21,130 rcf to remove insoluble debris. Every sample was divided in 2 x 300 l aliquots and 30 l were saved as Input » control and stored at -80 °C. Every aliquot was incubated with 6 g of -PTB (Ref. 32
5
hMeDIP Sequencing for 5-Hydroxymethylcytosine
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The hMeDIP sequencing was performed by KangChen Bio-tech, Shanghai, China. Briefly, DNA samples were fragmented to a size range of ∼200-1 000 bp with a DiagenodeBioruptor (Diagenode). About 1 μg of fragmented DNA was ligated to Illumina’s genomic adapters with Genomic DNA Sample Kit (FC-102-1002, Illumina), following the manufacturer’s instructions. Around 300–900 bp ligated DNA fragments were further denatured in 95°C into single strand DNA then immunoprecipitated by anti 5hmC antibody (Diagenode). The enriched DNA was amplified by PCR and purified by agarose gel. The completed libraries were quantified by an Agilent 2100 Bioanalyzer. The DNA fragments in well mixed libraries were denatured with 0.1 M NaOH to generate single-stranded DNA molecules for amplification, loaded onto channels of the flow cell at 8 pM concentrations, and amplified in situ using HiSeq3000/4000 PE Cluster Kit (PE-410-1001, Illumina). Sequencing was carried out by running 300 cycles useHiSeq4000 SBS Kit (FC-410-1003, Illumina).
6
ChIP Assay of Klb Promoter Region
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP assays were performed using a ChIP assay kit (Upstate, Lake Placid, NY) as we previously described.[50 ] Briefly, liver tissues were minced into small pieces and fixed with 1% of formaldehyde and were then homogenized in a glass dounce homogenizer to isolate nuclei, which were resuspended in nuclei lysis buffer and sonicated to shear genomic DNA to an average fragment length of 200–1,000 bp with a Diagenode Bioruptor (Diagenode, Denville, NJ). The lysates were centrifuged to obtain supernatants, which were used for immunoprecipitation. The DNAs extracted from the lysates were used for quantitative PCR analysis using the SYBR Green approach (Applied Biosystems). The sequences of primers for the Klb promoter regions were as follows: forward: 5’‐ATGAAATTACCCGTCAAACTC‐3’; Klb reverse: 5’‐CAATGATTAGCCTGGATCGG‐3’.
7
Genome-wide L1 retrotransposon profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA from fibroblast cell lines was extracted using the DNEasy Blood and Tissue Kit from Qiagen (Germantown, MD). DNA was sheared to approximate 750-1200 bp using a Diagenode BioRuptor on High, 30s on/30s off for 12 minutes. 50 ng of sheared gDNA was subject to a primer extension reaction using Taq polymerase and a L1 5’ UTR specific primer (L15’UTRP1) which sits ~100 bp from the start of the L1 element. Phosphorylated duplex T-linkers (IDT, Coralville, IA) were ligated using T4 DNA ligase. First round PCR was performed for 20 cycles using primers L15’UTRP1 and LinkerP1. One-million fold dilution of PCR I was performed and 1uL of this dilution was subjected to a nested PCR using primers L15’UTRP2 and LinkerP1 for 25 cycles. PCR products were run on a gel and a gel slice at ~500-700 bp was extracted using the Qiagen Gel Extraction kit. Following extraction, the final library was amplified using Phusion polymerase (Thermo, Waltham, MA) for 12 cycles as per the Illumina library generation protocol, and gel purified to yield the final 500-700 bp library.
8
ChIP Assay for p300 Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HPV 8E6 expressing and pLXSN control HaCaT cells were seeded at 3 x 106 cells per 10-cm dish and used for ChIP assay according to the protocol of the respective kit from Abcam. Briefly, cells were treated with formaldehyde at a final concentration of 0.75% and sonicated 4 times for 7 min each using a Diagenode Bioruptor (Diagenode). The cleared supernatant was incubated for 1 h at 4˚C with 3 μg of p300 monoclonal RW128 mouse antibody (Millipore) or mouse IgG1 (New England BioLabs). The immune complexes were precipitated with 60 μl protein A/G Sepharose (Santa Cruz Biotechnology) in the presence of salmon sperm DNA overnight at 4˚C. After elution of the protein-DNA complexes and reversing the cross-links, DNA was isolated and the C/EBPα regulatory region was detected and quantified by real-time PCR using the 5’-TAAGGCCACTGTCGGTGAAG-3’ and 5`-GAGCCCTCAAGTGTCTCCTG-3`primers and PowerUp SYBR Green (ThermoFisher Scientific). Results were normalized to isotype control.
9
Nuclear Protein Extraction Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were collected in PBS complemented with PIC (Roche). The pellets were collected by centrifugation and then resuspended in hypotonic buffer (10 mM Tris-HCl at pH 8.0, 1.5 mM MgCl2, 10 mM KCl, 1× PIC), and homogenized with a loose dounce homogenizer. Next, cells were supplemented with sucrose buffer (20 mM Tris-HCl at pH 8.0, 15 mM KCl, 60 mM NaCl, 0.34 mM sucrose [Sigma-Aldrich], 0.15 mM spermine [Sigma-Aldrich], 0.5 mM spermidine [Sigma-Aldrich], 1× PIC). The supernatant or cytoplamic extract was collected. The pellet was resuspended in sucrose buffer supplemented with high-salt buffer (20 mM Tris-HCl at pH 8.0, 25% glycerol [Fermentas], 1.5 mM MgCl2, 0.2 mM EDTA, 900 mM NaCl, 1× PIC) and incubated for 30 min on ice. The supernatant or nuclear extract was collected. The pellet was resuspended in sucrose buffer, sonicated with Diagenode Bioruptor (Diagenode), and used as the chromatin fraction.
10
Purification of LAB Fusion Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Codon-optimized coding sequences of LAB-1 and LAB-2 fused with a hexahistidine (6xHis) tag at the N-termini and a GFP or mCherry tag at the C-termini were cloned into pET-30a plasmid with the NdeI and HindIII digestion sites. BL-21 bacteria were transformed with the LAB protein-expressing plasmids or tag-only plasmids. Protein expression was induced with 0.5 mM IPTG at 16°C for 16 h. Induced proteins were extracted by sonication with Diagenode Bioruptor (Diagenode Inc.) in lysis buffer (50 mM Tris, 500 mM NaCl, 1% Triton X-100, and 10 mM imidazole, pH 7.4) supplied with 1mM PMSF and protease inhibitor mixture. Cell debris was removed at 11,000 g for 30 min at 4°C. 6xHis tagged proteins in the supernatants were captured with the HisPurTMNi-NTA Resin column (Thermo Fisher Scientific). After washing the column with wash buffer (50 mM Tris, 500 mM NaCl, and 30 mM Imidazole, pH 7.4), proteins were eluted with elution buffer (50 mM Tris, 500 mM NaCl, and 250 mM imidazole, pH 7.4). Eluted proteins were diluted with 50 mM Tris buffer to reduce NaCl concentration to 150 mM. Purified proteins were further concentrated with Amicon Ultra centrifugal filters (30 KD). Protein purification was analyzed by SDS-PAGE and protein concentration was measured.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!