Sall1flox mice were produced as described20 (link)27 (link). Foxd1GFPCre (012463) and R26R-tdTomato (007905) mice were obtained from the Jackson Laboratory3 (link)29 (link). The primers used for genotyping were as follows: Cre1 (5′–AGGTTCGTTCACTCATGGA–3′) and Cre2 (5′–TCGACCAGTTTAGTTACCC–3′) for the Cre allele (250 bp); Sall1 flox2 (5′–CCTCTGCCCGAGAGATCG–3′), Sall1flox3 (5′–GGCGCGTCTGATTTTATTTC–3′) for the Sall1 allele (wild-type: 220 bp; mutant: 280 bp). Polymerase chain reaction (PCR) amplifications were performed using GoTaq DNA polymerase (Promega) by denaturation at 95 °C for 2.5 min, followed by 35 cycles of 95 °C for 30 s, 58 °C for 60 s, and 72 °C for 30 s, and a final extension at 72 °C for 7 min. All animal experiments were performed in accordance with the institutional guidelines and approved by the licencing committee of Kumamoto University (#A27-018).
R26rtdtomato
Manufactured by Jackson ImmunoResearch
Sourced in United States
The R26RtdTomato is a genetically modified mouse line that expresses the red fluorescent protein tdTomato under the control of the ubiquitously expressed Rosa26 locus. This allows for the visualization of tdTomato expression in a variety of tissues and cell types.
Automatically generated - may contain errors
Lab products found in correlation
R26r eyfp, by Jackson ImmunoResearch (7 mentions)
Sftpccreert2, by Jackson ImmunoResearch (2 mentions)
Fgfr2fl fl, by Jackson ImmunoResearch (2 mentions)
Ai14 rcl tdt d r26rtdtomato, by Jackson ImmunoResearch (2 mentions)
Tsc1fl fl, by Jackson ImmunoResearch (2 mentions)
R26rtdtomato mice, by Jackson ImmunoResearch (2 mentions)
Gli1 creert2, by Jackson ImmunoResearch (2 mentions)
Tfcp2l1creert2, by Jackson ImmunoResearch (2 mentions)
Sftpcegfp, by Jackson ImmunoResearch (2 mentions)
Gotaq dna polymerase, by Promega (1 mentions)
C57b6 j, by Jackson ImmunoResearch (1 mentions)
Sprague dawley rats, by Taconic Biosciences (1 mentions)
Ascl1creert2 mice, by Jackson ImmunoResearch (1 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (1 mentions)
Glutamax, by Thermo Fisher Scientific (1 mentions)
Non essential amino acids (neaa), by Thermo Fisher Scientific (1 mentions)
Fsp1 cre mice, by Jackson ImmunoResearch (1 mentions)
Fsp1 cre, by Jackson ImmunoResearch (1 mentions)
R26r confetti, by Jackson ImmunoResearch (1 mentions)
17 protocols using r26rtdtomato
1
Generation and Characterization of Sall1-Deficient Mice
2
Targeting Chx10-Expressing Neurons
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All animal experiments and procedures were performed in laboratory mice (Mus musculus), carried according to the EU Directive 2010/63/EU, and approved by the Danish Animal Experiments Inspectorate (Dyreforsøgstilsynet, license no. 2017-15-0201-01172) and the local ethics committee at the University of Copenhagen.
For all behavioral experiments targeting the PPN, we used hemizygous Chx10Cre mice (same strain as previously reported7 (link),35 (link)). For targeting the vlPAG, we crossed hemizygous Chx10Cre mice with the homozygous conditional R26RChR2−EYFP line (stock no. 012569, Jackson Laboratories). For anatomical studies, we crossed hemizygous Chx10Cre mice with the homozygous conditional reporter lines R26REYFP or R26RtdTomato (stock no. 006148 and 007905, respectively, Jackson Laboratories). All experiments were performed in adult (>8 weeks) male or female mice (randomly selected, approximately 1:1) kept on a 12-h light–dark cycle with access to food and water ad libitum (housing temperature 23–24 °C, 45–65% humidity).
For all behavioral experiments targeting the PPN, we used hemizygous Chx10Cre mice (same strain as previously reported7 (link),35 (link)). For targeting the vlPAG, we crossed hemizygous Chx10Cre mice with the homozygous conditional R26RChR2−EYFP line (stock no. 012569, Jackson Laboratories). For anatomical studies, we crossed hemizygous Chx10Cre mice with the homozygous conditional reporter lines R26REYFP or R26RtdTomato (stock no. 006148 and 007905, respectively, Jackson Laboratories). All experiments were performed in adult (>8 weeks) male or female mice (randomly selected, approximately 1:1) kept on a 12-h light–dark cycle with access to food and water ad libitum (housing temperature 23–24 °C, 45–65% humidity).
3
Vertebrate Animal Husbandry and Genetic Strains
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All animals were maintained on ad libitum rodent chow and water and housed in a climate-controlled AALAC-accredited vivarium operating under a 12-h light/dark cycle. All protocols for the use of vertebrate animals are approved by the Committee for the Human Use of Animals at Tufts University School of Medicine. Eight-week old F1 mice were bred from C57/B6J and 129S1/Sv1MJ mice in house or were purchased from Jackson Laboratories (stock 101043). Adult male Sprague-Dawley rats were purchased from Taconic Biosciences (stock SD-M). Ascl1-CreERT2 mice (stock 012882), and the Cre reporter strain R26R(TdTomato) (stock 007909), constitutive GFP Tg(UBC-GFP) (stock 004353), and germline constitutive Tg(Sox2-Cre) (stock 004893) were purchased from Jackson Laboratories. K5-CreERT2 mice, Neurog1-CreERT2 mice, p63fl/fl mice, and ΔOMP-eGFP mice have been described elsewhere and were generously provided by P. Chambon via R. Reed (Indra et al., 1999 (link)), L. Goodrich (Kim et al., 2011 (link)), A. Mills (Mills et al., 2002 (link)), and P. Mombaerts (Potter et al., 2001 (link)), respectively. Pancellular-TdT mice were generated in house by breeding R26R(TdT) mice to Tg(Sox2-Cre) mice.
4
Genotyping and Mouse Lines for Lung Research
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Development and genotyping information for mouse lines SftpcCreERT2, Fgfr2fl/fl (Jackson Laboratory stock # 007569), R26REYFP (Jackson Laboratory stock # 007903), Ai14(RCL-tdT)-D (R26RtdTomato) (Jackson Laboratory stock # 007914), and Ect2fl/fl have been previously described (Chapman et al., 2011 (link); Madisen et al., 2010 (link); Windmueller et al., 2020 (link); Yu et al., 2003 (link)). Fgfr2fl/fl, R26RtdTomato, and R26REYFP mouse lines were purchased from the Jackson Laboratory. All mice were maintained on a mixed background (C57BL/6 and CD1). No obvious defects were observed in heterozygous mice, so SftpcCreERT2;Fgfr2fl/+;R26REYFP and SftpcCreERT2;Ect2fl/+;R26REYFP littermates were used as controls for all experiments except for the organoid experiments in Figure 4 where SftpcCreERT2;R26RtdTomato mice were used and the adult one month or longer influenza experiments in Figures 5C –5I ,6B , and 6D –6I where SftpcCreERT2;R26REYFP mice, including littermates, were used. Experiments were all performed with a minimum of n = 3 mice per condition of mixed gender, and unless otherwise stated each dot on a graph represents one mouse. All procedures for animal experiments were performed under the guidance of the University of Pennsylvania Institutional Animal Care and Use Committee.
5
Genotyping and Mouse Lines for Lung Research
6
Tsc1 Conditional Knockout Mouse Model
7
Isolating Fibroblast Lineage Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MEFs were isolated from E12.5. Gonads and internal organ were removed before processing for isolation of MEF cells. MEFs were growth in fibroblast growth medium (FGM) consisting of DMEM (Gibco), 15% fetal bovine serum (FBS, Gibco), 2 mM GlutaMAX (Gibco), 0.1 mM non-essential amino acids (NEAA) (Gibco), 100 units/mL penicillin, and 100 μg/mL streptomycin. For lineage-tracing experiments the Fsp1-Cre mice (Jackson Laboratory) were mated with R26RtdTomato mice (Jackson Laboratory) and isolated the Fsp1-Cre:R26RtdTomato (td-tomato-positive) MEFs from E12.5. TdTomato+-TTFs were isolated from adult (8–10 weeks) Fsp1-Cre:R26RtdTomato mice. Tail tips were cut into pieces and then dispersed on gelatin-coated 10 cm culture dishes containing 2 mL FGM, and an additional 8 mL FGM was supplemented on the next day.
8
Genetic Lineage Tracing in Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All aspects of mouse experiments were approved by the Finnish National Board of Animal Experimentation (ESAVI/1284/04.10.07/2016). The plug day was considered as embryonic day E0 and the date of birth as post-natal day P0. All embryos were staged according to limb morphological criteria.
Wild-type ICR mice and Rosa-R26R reporter transgenic mice [R26R-TdTomato (Madisen et al., 2010 (link)), R26R-Confetti (Snippert et al., 2010 (link)), and R26R-mT/mG (Muzumdar et al., 2007 (link))] were purchased from Jackson Laboratory, USA. Fucci (Sakaue-Sawano et al., 2008 (link)) fluorescent cell cycle reporter mouse strain was used for cell cycle analyses. The reporter lines were crossed with the K14-Cre43 line (Andl et al., 2004 (link)), kindly provided by Dr. Sarah Millar, to induce genetic recombination. R26R-mT/mG mice were crossed with aSMA-Cre line (LeBleu et al., 2013 (link)), kindly provided by Prof. Kari Alitalo, for recombination tests.
All tissues were fixed with 4% paraformaldehyde (PFA). For E17 and E18 stages, tissues were decalcified with EDTA prior embedding. For histology and immunohistochemistry, tissues were embedded in paraffin and 5 μm thickness sections were used.
Wild-type ICR mice and Rosa-R26R reporter transgenic mice [R26R-TdTomato (Madisen et al., 2010 (link)), R26R-Confetti (Snippert et al., 2010 (link)), and R26R-mT/mG (Muzumdar et al., 2007 (link))] were purchased from Jackson Laboratory, USA. Fucci (Sakaue-Sawano et al., 2008 (link)) fluorescent cell cycle reporter mouse strain was used for cell cycle analyses. The reporter lines were crossed with the K14-Cre43 line (Andl et al., 2004 (link)), kindly provided by Dr. Sarah Millar, to induce genetic recombination. R26R-mT/mG mice were crossed with aSMA-Cre line (LeBleu et al., 2013 (link)), kindly provided by Prof. Kari Alitalo, for recombination tests.
All tissues were fixed with 4% paraformaldehyde (PFA). For E17 and E18 stages, tissues were decalcified with EDTA prior embedding. For histology and immunohistochemistry, tissues were embedded in paraffin and 5 μm thickness sections were used.
9
Genotyping of Transgenic Mouse Lines for Genetic Analysis
10
Monitoring Stem Cell Activation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
C57BL/6J mice were purchased from Charles River Laboratories (Jiaxing, China) and Shanghai SLAC Laboratory Animal Co.Ltd (Shanghai, China). Gli1CreERT2, Lgr5EGFP−CreERT2, R26RtdTomato mice were purchased from the Jackson Laboratory. Gli1CreERT2; R26RtdTomato and Lgr5EGFP−CreERT2; R26RtdTomato mice were used to monitor the activation and proliferation of Gli1+ and Lgr5+ HFSCs after treatment. Four or six days after depilation, mice (6–7 weeks old) received three i.p. injections of 200 mg/kg Tamoxifen (MACKLIN, Shanghai, China) dissolved in corn oil (MACKLIN) at 1-day intervals. Mice were housed with a 12 h/12 h light/dark cycle at 22 °C, with free access to food and water. Only male mice were used for the experiments. The experimental study was conducted according to the institutional guidelines with approval from the Review Committee of Zhejiang Chinese Medical University.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!