Anti pten

Manufactured by Cell Signaling Technology

Sourced in United States, United Kingdom, China

Anti-PTEN is a primary antibody used to detect the PTEN (Phosphatase and Tensin Homolog) protein. PTEN is a tumor suppressor that regulates cell growth, proliferation, and survival. The Anti-PTEN antibody can be used in various applications, such as Western blotting, immunohistochemistry, and immunofluorescence, to study the expression and localization of PTEN in biological samples.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

Rabbit anti-PTEN (19 citations) Anti-PTEN antibody (18 citations) Anti-p-PTEN (9 citations) Rabbit anti-PTEN antibody (5 citations) Rabbit monoclonal anti-PTEN (3 citations) Anti-PTEN rabbit polyclonal antibody (3 citations) Rabbit monoclonal anti-PTEN antibody (2 citations) Anti-PTEN (9559) (2 citations) Anti-PTEN #9552 (2 citations) Rabbit anti-human PTEN antibody (2 citations)

172 protocols using anti pten

Western Blot Analysis of PTEN-PI3K-AKT Pathway

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells lysates extracted using radioimmunoprecipitation assay (RIPA) (Beyotime, Shanghai, China) were fractionated by electrophoresis and transferred on a polyvinylidene uoride (PVDF) membrane (Millipore).
The membrane was blocked in 5% nonfat skim milk and incubated with primary antibodies and secondary antibodies. Bands on the membrane were visualized by electrochemiluminescence (ECL; Pierce, Rockford, IL, USA). The primary antibodies used were as follows: anti-PTEN (1:1000), anti-PTEN (1:1000), anti-PI3K (1:1000), anti-AKT (1:1000), anti-phosphorylated-AKT (pAKT; 1:1000), (Cell Signaling Technology, Danvers, CO, USA).

Zhou Y., Deng Z., Pan T., Chen G., Cai Y., Tang Y., Wang Y., Wang Y., Li R., & Li L. (2022). LncRNA NORAD functions as a competing endogenous RNA to regulate KMT2D expression by targeting miR-204-5p in gastric cancer.

+ Open protocol

+ Expand

Western Blotting and Immunoprecipitation Methods

Check if the same lab product or an alternative is used in the 5 most similar protocols

For western blotting, cells were lysed in RIPA buffer (Boston BioProducts) supplemented with protease (Roche) and phosphatase (Roche) inhibitor. Proteins were separated on NuPAGE 4–12% Bis-Tris gradient gels (Invitrogen), transferred to polyvinylidine difluoride membranes (Immobilon P, Millipore) and the blots were probed with the indicated antibodies. For immunoprecipitation, U2OS, DU145, PC3, 293T, and MEF cells were transfected with the indicated expression vectors by using LIPOFECTAMIN 2000 (Life Technologies). Twenty-four hours after transfection, cells were lysed in RIPA buffer with protease (Roche) and phosphatase (Roche) inhibitor. Of total lysates, 500 mg were precleared for 30 minutes at 4°C and then immunoprecipitated with anti-Myc (Cell Signaling Technology 9B11, 1:500), or anti-PTEN (Cell Signaling Technology 9559, 1:500) antibody overnight at 4°C. The Protein-A or Protein-G sepharose beads (GE Healthcare) were then added and incubated for another 2 hours. The immunoprecipitates were washed with RIPA buffer three times. In denaturing conditions, standard Laemmli-Buffer with 5% final concentration of β-mercaptoethanol was added to the samples, which were then boiled and separated on NuPAGE 4–12% Bis-Tris gradient gels (Invitrogen).

Lee Y.R., Chen M., Lee J.D., Zhang J., Lin S.Y., Fu T.M., Chen H., Ishikawa T., Chiang S.Y., Katon J., Zhang Y., Shulga Y.V., Bester A.C., Fung J., Monteleone E., Wan L., Shen C., Hsu C.H., Papa A., Clohessy J.G., Teruya-Feldstein J., Jain S., Wu H., Matesic L., Chen R.H., Wei W, & Pandolfi P.P. (2019). Reactivation of PTEN tumor suppressor for cancer treatment through inhibition of a MYC-WWP1 inhibitory pathway. Science (New York, N.Y.), 364(6441), eaau0159.

+ Open protocol

+ Expand

Western Blot Analysis of HIF-1α, PTEN, and PI3K/AKT Pathway

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were lysed in RIPA lysis buffer at ice . An equal amount of protein (20μg) was subjected and fractionated using SDS-PAGE and transferred onto a polyvinylidene fluoride membrane (PVDF). Blocking the PVDF membranes in 3% bovine serum albumin in TBST buffer containing 0.1% Tween-20 for 1h at roomm temperature and incubating with the indicated primary antibodies at 4°C overnight. Appropriate secondary antibodies were incubated at room temperature for 1 h and detected using the enhanced chemiluminescence detection system. The data were adjusted against loading control using GAPDH. The primary antibodies were listed as followed: anti-HIF-1α(BD Biosciences, Bedford, MA, USA); anti-PTEN, anti-PI3K, anti-p-PI3K, anti-AKT, anti-p-AKT, anti VEGF, anti-GAPDH (Cell Signaling Technology).

Zhang Y., Chen Z., Feng L., Jiang P., Li X, & Wang X. (2019). Ionizing Radiation-inducible microRNA-21 Induces Angiogenesis by Directly Targeting PTEN. Asian Pacific Journal of Cancer Prevention : APJCP, 20(5), 1587-1593.

+ Open protocol

+ Expand

Podocyte PTEN and Nephrin Localization

Check if the same lab product or an alternative is used in the 5 most similar protocols

For biopsy samples, previous clinical renal biopsy reports were reviewed to identify biopsies from normal kidney donors (3 cases) and those with the diagnosis of diabetic nephropathy (4 cases). Tissue sections from these biopsies were subjected to double immunofluorescent staining for PTEN and nephrin.
For the animal model, kidney sections or isolated glomeruli were incubated with primary antibodies overnight at 4°C, subsequently incubated with corresponding Alexa-fluor secondary antibodies (Life Technologies) for 30 min at room temperature. The following antibodies were used: anti-PTEN (Cell Signaling, Cambridge, MA), anti-WT1 (Santa Cruz Biotechnology, Santa Cruz, CA), anti-nephrin (R&D Systems). For F-actin staining, secondary antibody was replaced by Alexa Fluor 488 phalloidin. Nuclei were stained with DAPI. For morphometric analysis, samples were imaged using a Nikon A1-Rs inverted Laser Scanning microscope or a Nikon Eclipse I 80 fluorescence microscope using 40× or 100× objectives. To visualize podocyte F-actin in glomeruli, z-Stacks were collected at 0.12-μm intervals over a range of 1.0~1.5μm. The z-stacks were processed and recombined using image J software. 20 glomeruli were examined per sample slide in a random fashion.

Lin J., Shi Y., Peng H., Shen X., Thomas S., Wang Y., Truong L.D., Dryer S.E., Hu Z, & Xu J. (2015). Loss of PTEN promotes podocyte cytoskeletal rearrangement, aggravating diabetic nephropathy. The Journal of pathology, 236(1), 30-40.

+ Open protocol

+ Expand

Protein Expression Analysis in HeLa Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

HeLa cells were lysed in 1% NP-40 lysis buffer containing 1% Nonidet P-40, 150 mM NaCl, 50 mM Tris-Cl (pH 8.0), 1 mM sodium orthovanadate, 1 mM DTT and proteinase inhibitors (halt inhibitor, Thermo #78442), and subjected to separation on 8 or 10% SDS-PAGE gels and Western blot (10 μg whole cell lysate per lane). Antibodies used for Western blot were anti-Bim (Cell Signaling, 2933), anti-Pten (Cell Signaling, 9559), anti-Phlpp2 (Bethyl, A300-661A-1), and anti-Ship1 (Cell Signaling, 2728).

Jin H.Y., Gonzalez-Martin A., Miletic A.V., Lai M., Knight S., Sabouri-Ghomi M., Head S.R., Macauley M.S., Rickert R.C, & Xiao C. (2015). Transfection of microRNA Mimics Should Be Used with Caution. Frontiers in Genetics, 6, 340.

+ Open protocol

+ Expand

Western Blot Analysis of PTEN

Check if the same lab product or an alternative is used in the 5 most similar protocols

Whole-cell lysis was performed as previously described [15 (link), 27 (link)]. The membranes were probed with anti-PTEN (1:1000, Cell Signaling, Danvers, USA) and anti-β-actin antibodies (1:2500, Santa Cruz Biotechnologies, Dallas, USA). Signals were visualized using the SuperSignal West Dura chemiluminescence kit (Thermo Fisher Scientific, Waltham, USA) and imaged on a Chemidoc gel imager (Bio-Rad, Hercules, USA). Images were quantified using the Image J software (NIH).

Dhar S., Kumar A., Rimando A.M., Zhang X, & Levenson A.S. (2015). Resveratrol and pterostilbene epigenetically restore PTEN expression by targeting oncomiRs of the miR-17 family in prostate cancer. Oncotarget, 6(29), 27214-27226.

+ Open protocol

+ Expand

Immunohistochemical Profiling of Oxidative Stress Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols

Immunohistochemical analysis was carried out using a standard avidin–biotin peroxidase complex method. Antibodies used in the study include: anti-8-oxo-dG (mouse monoclonal; JalCA), anti-nitrotyrosine (rabbit polyclonal; Millipore), anti-COX-2 (M-19; goat polyclonal; Santa Cruz), anti-Nrf2 (rabbit polyclonal; Santa Cruz), anti-Ki-67 (rabbit polyclonal, Abcam), anti-p-AKT (rabbit polyclonal; Abcam), and anti-PTEN (rabbit monoclonal; Cell Signaling Technology). Sections were then counterstained with hematoxylin. The total number of cells, the number of positively stained cells (including 1+, 2+, and 3+), and the immunostaining intensity were quantified using the Aperio ScanScope GL system (Vista, CA).

Chen J.X., Li G., Wang H., Liu A., Lee M.J., Reuhl K., Suh N., Bosland M.C, & Yang C.S. (2015). Dietary tocopherols inhibit PhIP-induced prostate carcinogenesis in CYP1A-humanized mice. Cancer letters, 371(1), 71-78.

+ Open protocol

+ Expand

Western Blot Analysis of Protein Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Protein separation and western blotting protocols were as described previously^{47 (link)}. Briefly, cells were lysed with RIPA solution, succeeded to SDS-PAGE gel electrophoresis, and the proteins transferred to PVDF membranes. The proteins were probed with anti-CISD2 (1:1,000 dilution; HPA015914, Sigma-Aldrich), anti-V5 (1:2,000 dilution; R960, Invitrogen), anti-GAPDH (1:10,000 dilution; MAB374, Millipore, Billerica, MA, USA), anti-E-cadherin (1:1,000 dilution; #3195, Cell Signaling Technology), anti-vimentin (1:1,000 dilution; #5741,Cell Signaling Technology), anti-ZO-1 (1:1,000 dilution; #5406, Cell Signaling Technology), anti-P21 (1:1,000 dilution; #2947,Cell Signaling Technology), anti-cytochrome C (1:1,000 dilution; GTX108585, GeneTex), anti-caspase 3 (1:1,000 dilution; GTX110543, GeneTex), anti-PARP1 (1:1,000 dilution; GTX100573, GeneTex), anti-EGR1 (1:1,000 dilution; #4153, Cell Signaling Technology), anti-PTEN (1:1,000 dilution; #9188, Cell Signaling Technology), anti-phospho-AKT Ser473 (1:1,000 dilution; (#4060, Cell Signaling Technology), and anti-AKT1 (1:1,000 dilution; #2938, Cell Signaling Technology) antibodies, and then further probed by horseradish peroxidase-conjugated secondary antibodies.

Li S.M., Chen C.H., Chen Y.W., Yen Y.C., Fang W.T., Tsai F.Y., Chang J.L., Shen Y.Y., Huang S.F., Chuu C.P., Chang I.S., Hsiung C.A, & Jiang S.S. (2017). Upregulation of CISD2 augments ROS homeostasis and contributes to tumorigenesis and poor prognosis of lung adenocarcinoma. Scientific Reports, 7, 11893.

+ Open protocol

+ Expand

Western Blotting Analyses of PI3K Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols

Western blotting analyses were performed using the following antibodies: anti PI3K-C2α, anti PI3K-C2β (BD Transduction Laboratories); anti p110β, anti p110α, anti pERK1-2 (Thr202-Tyr204), anti pMEK1-2 (Ser217-221), anti PTEN, anti TCF8/ZEB1, anti ZO-1, anti β catenin, anti Vimentin, anti Claudin-1, anti Slug (Cell Signaling Technology); anti Tubulin, anti ERK2, anti Actin (Santa Cruz Biotechnology); anti GAPDH (Abcam); anti-rabbit IgG, anti-mouse IgG (Sigma Aldrich, UK). Transient downregulation of enzymes of interest was obtained using the following siRNAs: PI3K-C2β (sequence 1): AAGAATGCGACGCCTGGCAAG (Qiagen); PI3K-C2β (sequence 2): Cat. No. J-006772-08 (Dharmacon); p110β (Dharmacon, smartpoolA); Slug: Cat. No. J-017386-05 (Dharmacon). Non-targeting siRNAs (Ambion or Dharmacon), designated as ‘si NC’, were used as control.

Mavrommati I., Cisse O., Falasca M, & Maffucci T. (2016). Novel roles for class II Phosphoinositide 3-Kinase C2β in signalling pathways involved in prostate cancer cell invasion. Scientific Reports, 6, 23277.

+ Open protocol

+ Expand

Immunoblotting of Cellular Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were lysed with ice-cold RIPA buffer (Pierce, #89900) supplemented with 1× Complete Mini inhibitor mixture (Roche, #11 836 153 001) and mixed on a rotator at 4°C for 30 minutes. Protein concentration of the cell lysates was quantified using the Bio-Rad DC Protein Assay (Catalog #500-0114). 50–80 μg of total protein was separated on 4–12% Bis-Tris gradient gels (Life Technologies) by SDS-PAGE and then transferred to nitrocellulose membranes. The following antibodies were used for immunoblotting: anti-FLAG (Sigma, F1804, 1:1,000), anti-Hsp90 (BD, #610418, 1:10,000), anti-Pten (Cell Signaling, 9188, 1:1,000), anti-TTF1/Nkx-2.1 (Epitomics, EP1584Y, 1:1,000).

Sánchez-Rivera F.J., Papagiannakopoulos T., Romero R., Tammela T., Bauer M.R., Bhutkar A., Joshi N.S., Subbaraj L., Bronson R.T., Xue W, & Jacks T. (2014). Rapid modeling of cooperating genetic events in cancer through somatic genome editing. Nature, 516(7531), 428-431.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!