Cell culture HUVEC primary human umbilical vein endothelial cells (CC-2517, Lonza) were grown in endothelial basal medium (EBM-2, CC-3156, Lonza) supplemented with 2% FBS, hFGF-β, hydrocortisone, VEGF, R3-IGF-1, ascorbic acid, heparin, hEGF and GA-1000 (SingleQuots supplement, C-4176, Lonza). HMEC primary human blood microvascular endothelial cells (CC-2813, Lonza) were grown in endothelial basal medium (EBM-2, CC-3156, Lonza) supplemented with 5% FBS, hFGF-β, hydrocortisone, VEGF, R3-IGF-1, ascorbic acid, hEGF and GA-1000 (SingleQuots supplement, C-4147, Lonza). Both cell lines were seeded in T75 flasks and grown at 37°C in a humidified incubator with 5% CO2. The medium was replaced every 2-3 days and cells were grown to near confluence and passaged when required. Both endothelial cell lines were used until passage 10.
Cc 3156
Manufactured by Lonza
Sourced in Switzerland, United States, United Kingdom
The CC-3156 is a compact and versatile laboratory equipment designed for general laboratory applications. It provides a consistent and reliable performance for various experimental needs. The core function of the CC-3156 is to facilitate precise measurements and controlled environments for laboratory-scale research and development activities.
Automatically generated - may contain errors
Lab products found in correlation
Cc 4176, by Lonza (12 mentions)
Huvecs, by Lonza (7 mentions)
Ebm 2, by Lonza (5 mentions)
Cc 4147, by Lonza (4 mentions)
Cc 2813, by Lonza (2 mentions)
Cc 3162, by Lonza (2 mentions)
Hoechst 33342, by Thermo Fisher Scientific (2 mentions)
Penicillin and streptomycin, by Thermo Fisher Scientific (2 mentions)
Lsm 780, by Zeiss (2 mentions)
Hvegf 165, by Merck Group (1 mentions)
Hvegf165, by Thermo Fisher Scientific (1 mentions)
Sphingosine 1 phosphate (s1p), by Merck Group (1 mentions)
M4125, by Merck Group (1 mentions)
Haoec, by Lonza (1 mentions)
V900429, by Merck Group (1 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
Egm 2 bulletkit medium, by Lonza (1 mentions)
Antibiotic and antimycotic solution, by Thermo Fisher Scientific (1 mentions)
Cls3603, by Corning (1 mentions)
Hyclone, by Thermo Fisher Scientific (1 mentions)
47 protocols using cc 3156
1
Culturing primary human endothelial cells
2
Endothelial Cell Culture with ssEVs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human microvascular endothelial cells (HMVECs) and mouse primary MVECs were cultured as we described previously.5 , 8 , 27 HMVECs were treated with or without ssEVs (108 particles/mL, 48 hours) in exosome‐free FBS (10%) culture medium (EBM‐2, CC‐3156 plus CC‐4147 excluded FBS, Lonza) for 48 hours after 6 hours starvation (0% FBS). To explore the role of EZH2, HMVECs were treated with EZH2‐specific inhibitor GSK343 (0.1 µM) for 48 hours. HMVECs treated with the standard culture medium (EBM‐2, CC‐3156 plus CC‐4147, Lonza) in the presence of 10% exosome‐free FBS with or without vehicle (vehicle 0.1% DMSO) served as respective controls.
3
Angiogenic Factors Stimulate Vascular Sprouting
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HMVEC vessels were cultured for 3 days, in medium with HHS, before a gradient of angiogenic factors was applied. The bottom perfusion channels of the OrganoPlate 3-lane were washed with EBM2 medium (30 µL of medium per well) for 10 min. Stock solutions of the angiogenic factors were prepared as follows: 100 µg/mL hVEGF-165 (Preprotech, 100–20) in 0.1% BSA in PBS, 1 mM Sphingosine-1-Phosphate (S1P, Sigma, G00918) in 5% 1 M HCl, 95% DMSO, and 10 µg/mL Phorbol Myristate Acetate (PMA, Sigma, P1585) in 0.1% DMSO/MilliQ. Angiogenic factors were diluted in EBM2/EGM-2MV/HHS culture medium and used at the following concentrations: 50 ng/mL hVEGF-165, 2 ng/mL PMA, and 500 nM S1P. All medium was aspirated and fresh medium without angiogenic cocktail was added to the top perfusion channel (15 µL per in/outlet) while medium with the angiogenic cocktail was added to the bottom perfusion channel (15 µL per in/outlet). Angiogenic sprouts were monitored by phase contrast microscopy until ready for assays which was after 4 days of stimulation.
After 4 days of sprout stimulation, the medium with angiogenic cocktail was replaced with basal medium (Lonza CC-3156) without angiogenic cocktail containing antibiotics (GA-1000 from EGM-2MV kit), HHS at 2% or 5% final concentration.
After 4 days of sprout stimulation, the medium with angiogenic cocktail was replaced with basal medium (Lonza CC-3156) without angiogenic cocktail containing antibiotics (GA-1000 from EGM-2MV kit), HHS at 2% or 5% final concentration.
4
Baicalin Modulates Endothelial Stress
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human umbilical vein endothelial cells (HUVECs) and human aortal endothelial cells (HAOECs) were purchased from Lonza, Basel, Switzerland and cultured in endothelial cell growth medium-2 (EGM-2, CC-3156 & CC-4176, Lonza) at 37°C in a 5% CO 2 humidified incubator until the start of experiment. Five to seven passage subconfluent cells were used in the experiments. Before starting the experimental procedures, the medium was removed and replaced with phenol red-free low-glucose DMEM (11054020, Gibco BRL) supplemented with 1% calf serum (16010159, Gibco BRL) for 12 h, and then endothelial cells were placed in EGM-2 consisting of either NG (5.5 mM) or HG (33 mM) in the presence or absence of Baicalin (50 μM) for 72 h, mannitol (MAN, 33 mM: 5.5 mM of glucose + 27.5 mM of D-mannitol; M4125, Sigma-Aldrich) was served as the osmotic control for the HG, pharmacological antioxidant molecules N-Acetyl-L-cysteine (NAC, 2 mM; V900429, Sigma-Aldrich) was pretreated for 2 h every day to evaluate the effect of Baicalin on the oxidative stress. Media were changed every 24 h. For signaling pathway analysis, each pathway antagonist: LY294002 (10 μM) and ML385 (20 μM) were pretreated for 2 h every day before Baicalin administration. All described experiments were independently carried out at least 3-6 separate times, with endothelial cells used between passages 3 to 20.
5
Ex vivo Aortic Ring Assay for Endothelial Function
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ex vivo aortic ring assays were carried out as previously described [64] (link). Briefly, C57BL/6 male mice (6–8 w) were sacrificed by CO2 inhalation. The isolated thoracic aortas were washed with serum-free RPMI 1640 media, cleaned of connective tissue, and divided into 1–2 mm rings, that were then cultured with endothelial cell basal medium (Lonza, CC-3156) supplemented with 10% fetal bovine serum (Gibco). Adenovirus vectors (Hanbio Biotechnology) expressing a control shRNA or an shRNA targeting mouse ERO1A (CAGCTCTTCACTGGGAATAAA), GFP or HA-GPx7 cDNA were transduced into the cultured aortic rings, which were then cultured for 48–72 h. Phosphate-buffered saline (PBS) or 200 μM Hcy was added, and after 4 h the aortic rings were lysed, followed by immunoblotting analysis.
6
Culturing and Cryopreserving HUVECs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primary Human Umbilical Vein Endothelial Cells (HUVECs) were purchased from Lonza (C2519AS) and used up to passage five. Early passage HUVECs were cultured in EGM™2-Bulletkit™ medium with growth supplements CC-3156 & CC-4176 purchased from Lonza. At 80% confluency, HUVECs were trypsinized, washed twice with phosphate-buffered saline (PBS), pelleted, and frozen at −80°C.
7
Evaluation of Endothelial Cell Proliferation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HPAECs (untreated, treated with exosomes, untransfected or transfected with control miRNA, miR-181, miR-324, ETS-1 siRNA, Notch4 siRNA, as appropriate) were grown in 96-well black polystyrene microplates with clear bottom (Corning, CLS3603) at the cell density of 15,000 cells per well. The cells were pre-starved in growth factor-depleted EGM2 medium containing 2% FCS for 8 h. In all, 50 ng/mL of VEGF165 (R&D, 293-VE) was added together with 10 µM EdU 18 h before the end of experiment.
ECFCs from healthy donors and IPAH patients were seeded into 96-well black polystyrene microplates with clear bottom at the cell density of 15,000 cells per well and cultured for 8 h in growth factor-free EGM-2 medium (CC-3156, Lonza Biologics, Slough, UK), supplemented with 5% FBS (HyClone, Thermo Scientific, South Logan, UT, USA) and 1% antibiotic and antimycotic solution (Gibco, Invitrogen, Paisley, UK). Ten micromolar EdU was added to the cells and the cells were incubated for further 18 h. HPAECs and ECFCs were then fixed and stained as described in the EdU proliferation assay for HPASMCs. Instead of Nuclear Green, in some experiments cell nuclei were labelled with 0.1 μg/mL Hoechst 33342 (Thermofisher, 62249) and detected at Ex/Em 361/421 nm.
ECFCs from healthy donors and IPAH patients were seeded into 96-well black polystyrene microplates with clear bottom at the cell density of 15,000 cells per well and cultured for 8 h in growth factor-free EGM-2 medium (CC-3156, Lonza Biologics, Slough, UK), supplemented with 5% FBS (HyClone, Thermo Scientific, South Logan, UT, USA) and 1% antibiotic and antimycotic solution (Gibco, Invitrogen, Paisley, UK). Ten micromolar EdU was added to the cells and the cells were incubated for further 18 h. HPAECs and ECFCs were then fixed and stained as described in the EdU proliferation assay for HPASMCs. Instead of Nuclear Green, in some experiments cell nuclei were labelled with 0.1 μg/mL Hoechst 33342 (Thermofisher, 62249) and detected at Ex/Em 361/421 nm.
8
Culturing Human Umbilical Vein Endothelial Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
9
Isolation and Culture of Dermal Endothelial Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primary human dermal LECs were gifted from Young Kwon Hong (USC) (9 (link)). LECs were isolated from dermal tissues of neonatal donors. Primary human dermal BECs were purchased from Lonza (CC-2813, HMVEC-dBlNeo, Lonza). BECs were derived from dermal tissues of neonatal donors. Both endothelial cell types were originated from the same tissue type (“skin”) of “neonatal” donors. LECs were cultured in EBM media (Lonza, CC-3121), containing 15% fetal bovine serum (Sigma), 2 mM L-glutamine (Sigma, G7513), 10 μg/mL hydrocortisone acetate (Sigma, H0396), 2.5 × 10−2 mg/mL N-6,2′-O-dibutyryl-adenosine 3′,5′-cyclic monophosphate (Sigma, D0627), and 50 μg/mL Gentamycin (Life Technologies). BECs were cultured in EGM-2MV media (Lonza, CC-3156 & CC-3202). All the cells were used at passages 3-6 and maintained in standard tissue culture incubators at 37 °C, 95% humidity, and 5% CO2.
10
Culturing Fibroblasts and Endothelial Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human dermal fibroblast cell line CCD-986Sk (CRL-1947, ATCC, USA) was cultured in Iscove’s modified Dulbecco’s medium (31980-030, Thermo Fisher Scientific, USA) supplemented with 10% fetal bovine serum. Primary human umbilical vein endothelial cells (HUVECs, C2517A, Lonza, Switzerland) were cultured in endothelial basal growth medium (CC-3156, Lonza) supplemented with EGM-2 SingleQuots (CC-4176, Lonza). All cells were cultured in an incubator (37°C, 5% CO2), and the culture medium was changed every 2 days.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!