Total RNAs of samples were isolated using TRIzol Reagent (Invitrogen). The first strand of cDNA was synthesized from 5μg of total RNA using the M-MLV reverse transcriptase (Promega). The quantitative Real-Time PCR (qRT-PCR) was conducted with gene-specific primers (Table S1 ) in a 96-well plate by Bio-Rad CFX96 real-time PCR system, using 2× SYBR Green Master Mix reagent (Bio-Rad). The thermal cycles were as follows: 95 °C for 5 min; 40 cycles of 95 °C for 10 s, primer-specific annealing temperature for 10 s, and 72 °C for 15 s; and then melt curve from 65 to 95 °C. Reference genes were selected according to each experimental condition, as described in Table S2 [30 (link)]. Based on the corresponding reference gene(s), the relative expression levels of OsDUF668 genes were calculated using the Bio-Rad CFX Manager 2.1 software (tissues), and additionally, log2 (experimental treatments).
Sybr green master mix reagent
Manufactured by Bio-Rad
Sourced in United States
SYBR Green Master Mix is a ready-to-use reagent for quantitative real-time PCR (qPCR) analysis. It contains SYBR Green I dye, which binds to double-stranded DNA, and all the necessary components for performing qPCR reactions.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (5 mentions)
Cfx96 real time pcr system, by Bio-Rad (5 mentions)
M mlv reverse transcriptase, by Promega (4 mentions)
Cfx96 real time system, by Bio-Rad (4 mentions)
Primescript rt reagent kit, by Takara Bio (2 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Cfx manager 2, by Bio-Rad (1 mentions)
Iscript reverse transcriptase kit, by Bio-Rad (1 mentions)
Icycler, by Bio-Rad (1 mentions)
Rnaeasy mini kit, by Qiagen (1 mentions)
Random hexamer primer, by Thermo Fisher Scientific (1 mentions)
Cfx384 real time system, by Bio-Rad (1 mentions)
Primescript 4 1st strand cdna synthesis mix, by Takara Bio (1 mentions)
Fastking rt kit with gdnase, by Tiangen Biotech (1 mentions)
Rna extraction kit, by Qiagen (1 mentions)
Revertra ace qpcr rt master mix, by Toyobo (1 mentions)
Direct zol rna miniprep kit, by Zymo Research (1 mentions)
Iscript cdna synthesis kit, by Bio-Rad (1 mentions)
Rnaiso plus, by Takara Bio (1 mentions)
Rneasy plus kit, by Qiagen (1 mentions)
16 protocols using sybr green master mix reagent
1
Quantitative Real-Time PCR Analysis of OsDUF668 Genes
2
Quantitative Real-Time RT-PCR for Rice Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Samples were collected and immediately frozen in liquid nitrogen, then stored at –80°C. Total RNA was extracted using TRIzol reagent (Invitrogen). After RNase-free DNase treatment, 5 μg of RNA was used for cDNA synthesis using M-MLV reverse transcriptase (Promega) in a 50-μl reaction mixture. The quantitative, real-time reverse transcription polymerase chain reaction (qRT-PCR) technique was performed using 2×SYBR Green Master Mix reagent (Bio-Rad) in a 96-well plate using a Bio-Rad CFX96 real-time PCR system. Three technological replicates were used for each biological sample. Six rice reference genes (from our unpublished data on the selection of stable reference genes to normalise gene expression in rice) were assessed for their potential as stable internal standards by geNorm as previously described (Vandesompele et al., 2002 (link)). These genes were TI (LOC_Os01g05490), ARF (LOC_Os05g41060), EF-1α (LOC_Os03g08020), UBC (LOC_Os02g42314), Profilin-2 (LOC_Os06g05880), and Actin1 (LOC_Os03g50885). As a result of this analysis, UBC, Profilin-2, and Actin1 were selected as internal standards for all leaf samples (Supplementary Figure S1 ). All primers used for qRT-PCR analysis are listed in Supplementary Table S3 , with good PCR efficiencies (85–105%) assessed using a 10-fold dilution series of total cDNA.
3
Transcriptome Analysis of Rice Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The collected samples were immediately frozen in liquid nitrogen, and then stored at −80°C before use. Total RNAs of the various tissues were isolated with the TRIzol reagent (Invitrogen). After the DNase treatment, about 5 μg of RNAs were used for the cDNAs synthesis that utilized the M-MLV reverse transcriptase (Promega) in a 50-μl reaction mixture. Quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) was performed with the 2 × SYBR Green Master Mix reagent (Bio-Rad) in a 96-well plate of the Bio-Rad CFX96 real time PCR system. Eight rice reference genes: TI (LOC_Os01g05490), ARF (LOC_Os05g41060), EF-1α (LOC_Os03g08020), UBC (LOC_Os02g42314), Profilin-2 (LOC_Os06g05880), Edf (LOC_Os08g27850), PtfS (LOC_Os07g34589), and Actin1 (LOC_Os03g50885), were used to find the stable internal standards by geNorm as described (Vandesompele et al., 2002 (link); Wang et al., 2016 (link)). The selected internal standards for the different experimental conditions were showed in Figure S1 . All primers used for qRT-PCR analysis are listed in Table S3 , with good PCR efficiencies (80–100%) detected by using ten-times diluted gradients of the total cDNAs.
4
Quantifying RANKL Expression in B Cells under T. forsythia Infection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Reverse transcription quantitative PCR (RT-qPCR) analysis was performed to assess the levels of RANKL mRNA in B cells in response to T. forsythia infection. For this purpose, B cells from spleens of sham—and T. forsythia—infected mice were purified and then stimulated with T. forsythia at an m.o.i. of 50 and 100 for 48 h. After stimulation, toral RNA was isolated from B cells with an RNAeasy mini kit (Qiagen) incorporating DNase treatment as per the manufacturer’s protocol. Retrotranscription of RNA (500 ng) into cDNA was performed with iScript reverse transcriptase kit (Bio-Rad laboratories). Quantitative real-time PCR was performed with a Bio-Rad iCycler (Bio-Rad) using SYBR Green master mix reagent (Bio-Rad). Two step PCR was performed with 94°C for 15 s and 58°C for 30 s for 40 cycles. Gene expression values were calculated based on the 2–ΔΔCt method using Gapdh expression as an internal control. The primer sequences were: GAPDH, 5′-GGATGCAGGGATGATGTTCT-3′ and 5′-AACTTTGCCATTGTGGAAGG-3′; RANKL, 5′-AGCCATTTGCACACCTCAC-3′ and 5′-CGTGGTACCAAGA GGACAGAGT-3′.
5
Quantifying Mouse Lung Inflammation Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA from mouse lung tissue was isolated using TRIzol reagent (Life Technologies) and reverse transcribed. Quantitative PCR was performed on the Bio-Rad C1000 real-time PCR system using SYBR green Master Mix reagent (Bio-Rad). GAPDH was used as an internal control for normalization. The data were analyzed using the 2−ΔΔCt formula. The sequences of the primers for mouse gene expression are listed (forward and reverse):
IL-1β: 5′-CTCGTGCTGTCGGACCCAT and 5′-CAGGCTTGTGCTCTGCTTGTGA;
TNF-α: 5′-ATCCGCGACGTGGAACTGGC and 5′-CCATGCCGTTGGCCAGGAGG;
IL-8: 5′-CGGCAATGAAGCTTCTGTAT and 5′-CCTTGAAACTCTTTGCCTCA;
MCP-1: 5′-AGTTAACGCCCCACTCACCT and 5′-TCCTTCTTGGGGTCAGCACA;
iNOS: 5′-AAGTCCAGCCGCACCACCCT and 5′-GTCCGTGGCAAAGCGAGCCA;
GAPDH: 5′-ATCTCCGCCCCTTCTGCCGA and 5′-CCACAGCCTTGGCAGCACCA.
IL-1β: 5′-CTCGTGCTGTCGGACCCAT and 5′-CAGGCTTGTGCTCTGCTTGTGA;
TNF-α: 5′-ATCCGCGACGTGGAACTGGC and 5′-CCATGCCGTTGGCCAGGAGG;
IL-8: 5′-CGGCAATGAAGCTTCTGTAT and 5′-CCTTGAAACTCTTTGCCTCA;
MCP-1: 5′-AGTTAACGCCCCACTCACCT and 5′-TCCTTCTTGGGGTCAGCACA;
iNOS: 5′-AAGTCCAGCCGCACCACCCT and 5′-GTCCGTGGCAAAGCGAGCCA;
GAPDH: 5′-ATCTCCGCCCCTTCTGCCGA and 5′-CCACAGCCTTGGCAGCACCA.
6
Quantitative Analysis of NfdsRNase Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression of NfdsRNase was determined by quantitative RT-PCR (RT-qPCR). Heads, thoraxes, and abdomens were dissected from 50 to 80 N. fulva workers and instantly frozen in liquid nitrogen. For expression analysis of worker ants subjected to RNAi assays, entire bodies or abdomens of ∼40 workers were pooled in each replicate of each treatment and frozen in liquid nitrogen. All samples for gene expression analysis were stored at −80°C until further processing. Total RNA extraction and cDNA synthesis using random hexamer primers (Invitrogen, Carlsbad, CA, United States) were conducted as described above. Primers used in qPCR analysis were shown in Table 1 . The 60S ribosomal protein L4 gene (NfRPL4) served as the internal control (Meng et al., 2020 (link)). qPCR reactions were run on a CFX384 Real-Time System (BioRad) using SYBR Green Mastermix reagent (BioRad). Relative fold changes of gene expression were calculated as we previously described (Zhu-Salzman et al., 2003 (link)).
7
Quantitative RT-PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative RT-PCR (qPCR) were used to detect the mRNA level and were performed as described previously 19 (link). Briefly, total RNAs from cells were extracted using the TRIzol reagent (Invitrogen) according to the manufacturer's instruction. For first cDNA synthesis, total RNAs were performed reverse transcription using PrimeScript™ IV 1st strand cDNA Synthesis Mix (6215A, TakaRa, Japan). SYBR Green Master Mix reagent (Bio-Rad) and other reactants were carried out at 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s and 65 °C for 15 s in CFX96 Real-Time System (Bio-Rad). GAPDH was used as an endogenous reference gene to normalize target gene expression by the ΔΔCt method. QPCR primer sequences are listed below: GAPDH-F: 5'-TGGACTCCACGACGTACTCA-3', GAPDH-R: 5'-AATCCCATCACCATCTTCCA-3'; CDH1-F: 5′-GGATGTGCTGGATGTGAATG-3′, CDH1-R: 5′-CACATCAGACAGGATCAGCAGAA3′; CDH2-F: CTGACACTGGTGGCACTACTAA, CDH2-R: ATTCTGGTACACAATACAGAGGCA; MMP2-F: AGCTAATCAGCATTCTCACTCCTAC, MMP2-R: CACAGAAGGTTGTGAAAGGAGAAGA, MMP9-F: AGATTGGGAACCAGCTGTATTTGTT; MMP9-R: AAGAAGAAAAGCTTCTTGGAGAGCC; VEGFA-F: ATTGTGGAGGCAGAGAAAAGAGAAA, VEGFA-R: AACCGGTACAAATAAGAGAGCAAGA.
8
Pepper Leaf RNA Extraction and qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from pepper leaves using the E.Z.N.A.R® Plant RNA Kit (OMEGA, United States). To avoid degradation, all steps were accomplished at low temperature. The first strand cDNA was synthesized from 1 µg of total RNA using FastKing RT Kit (with gDNase) (TIANGEN, China) according to the manufacturer’s instructions.
Gene-specific primers for Quantitative Real-Time PCR (qRT-PCR) were designed using the Genscript online tool (https://www.genscript.com/tools/real-time-pcr-taqman-primer-design-tool ). The pepper GAPDH gene was utilized as an endogenous reference gene for normalizing the expression levels. The reaction system of qRT-PCR analysis followed the instructions of SYBR Green Master Mix reagent of Vazyme with 20 µl reaction mixture of volume on CFX96 Real-Time System (Bio-Rad, United States) . All qRT-PCRs were performed in triplicate and the expression data were calculated by the 2−ΔΔCt method.
Gene-specific primers for Quantitative Real-Time PCR (qRT-PCR) were designed using the Genscript online tool (
9
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs from target cells were extracted using the RNA extraction kit (Qiagen, Germany) according to the manufacturer’s instruction. For cDNA synthesis, total RNAs were performed reverse transcription using ReverTra Ace qPCR RT Master Mix (FSQ-201, Toyobo, Japan). SYBR Green Master Mix reagent (Bio-Rad) and other reactants were carried out at 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s and 65 °C for 15 s in CFX96 Real-Time System (Bio-Rad). GAPDH was used as an endogenous reference gene to normalize target gene expression by the ΔΔCt method. qPCR primer sequences are listed below: GAPDH-F: 5′-TGGACTCCACGACGTACTCA-3′, GAPDH-R: 5′-AATCCCATCACCATCTTCCA-3′; CDH1-F: 5′-GGATGTGCTGGATGTGAATG-3′, CDH1-R: 5′-CACATCAGACAGGATCAGCAGAA3′: KLF6-F: 5′-GGCAACAGACCTGCCTAGAG-3′, KLF6-R: 5′-CTCCCGAGCCAGAATGATTTT-3′; EGFR-F: 5′-AAGTGTAAGAAGTGCGAAGG-3′, EGFR-R: 5′-GGAGGAGTATGTGTGAAGGA-3′.
10
Total RNA Isolation and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For total RNA isolation, PS/PO samples from wells of 12-well plates were collected from Matrigel® cultures using Dispase® as described above. PS and PO pellets were dissolved in Trizol reagent before processing by Direct-Zol RNA miniprep kit according to the manufacturer’s instructions (Zymo Research; Cat. No. 11-331). cDNA synthesis was conducted by iScript cDNA synthesis kit (Bio-Rad, Cat. No. 1708891). Quantitative real-time PCR was conducted using SYBR green master mix reagent (Bio-Rad; Cat. No. 1725271) with CFX96 Real-Time system (Bio-Rad). Primer sequences are provided in Table S1. Data were analyzed with method and normalized to the housekeeping gene RPL13.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!