Qx100 system
The QX100 system is a digital PCR (dPCR) platform designed for high-precision nucleic acid quantification. The system uses a water-oil emulsion droplet technology to partition samples into thousands of individual reaction chambers, enabling sensitive and accurate measurement of target DNA or RNA molecules. The QX100 system provides reliable and reproducible results for a variety of applications, including gene expression analysis, rare mutation detection, and copy number variation analysis.
Lab products found in correlation
34 protocols using qx100 system
Droplet Digital PCR Quantification Protocol
Digital Droplet PCR for Viral DNA
Droplet Digital PCR Mutation Screening
The optimized PCR thermal profile was conducted on a conventional PCR machine (Vetiti, Applied Biosystems). Thermal cycling consisted of a 10 min activation period at 95 °C followed by 40 cycles of a two-step thermal profile of 15 s at 95 °C denaturation and 60 s at 60 °C for combined annealing-extension and 1 cycle of 98 °C for 10 min. All samples were analyzed in three replicates. Results were analyzed with the QuantaSoft v.1.2.10.0 software (BioRad Laboratories, Inc., Shanghai, China). The workflow and data analysis were described in our previous report25 (link).
Quantifying Mammary Gland Gene Expression
Droplet Digital PCR for Genomic Analysis
Quantification of Viral RNA in Samples
Absolute Quantification of Gene Expression via Digital PCR
Quantification of HIV DNA in PBMC
Droplet Digital PCR for JAK2V617F Mutation Detection
The JAK2V617F primer/probe assay included a forward primer: GCTTTCTCACAAGCATTTG, a reverse primer: GCATTAGAAAGCCTGTAGTTTTA, and two probes: Fam-TCGTCTCCACAGAaACATACTCCATGAGACGA-BHQ1 (mutant c.1849G>T) and Hex-TCGTCTCCACAGACACATACTCCATGAGACGA-BHQ1 (wildtype).
Quantification of DNA Molecules by Real-time and Droplet Digital PCR
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!