ABT-263 (Navitoclax), 3-MA (3-methyladenine) and Rapamycin (Sirolimus) were purchased from Selleck Chemicals (TX, USA). The primary Rabbit monoclonal antibodies of Bcl-2, Bax, Beclin-1(Becn), Atg5, LC-3, Trem-2, and Tubulin-α conjugated with Alexa Fluor® 790 were acquired from Abcam (Cambridge, UK). The secondary antibodies Goat anti-Rabbit IgG H&L (Alexa Fluor®680) was purchased from Abcam as well. The DAPI (4′, 6-diamidino-2- phenylindole) was obtained from Beyotime (Shanghai, China). The F4/80-PE anti-mouse antibody, PE Rat IgG2a isotype and biotin anti-mouse CD16/32 antibody were purchased from Biolegend (San Diego, CA). The Phallodin-iFluor 633 Conjugate was purchased from ATT Bioquest® (Sunnyvale, CA). The cell culture reagents, RPMI 1640 and FBS (fetal bovine serum) were purchased from Biological Industries (Cromwell, CT). The RT2 First Strand kit and Profiler PCR Array (PAXX-084) and SYBR Green qPCR master mix were purchased from Qiagen (Hilden, Germany). Proteome Profiler Array of Mouse cytokine (ARY006) was purchased from R&D systems, Inc. (MN, USA).
Rapamycin sirolimus
Manufactured by Selleck Chemicals
Sourced in United States
Rapamycin (Sirolimus) is a macrolide compound that functions as an mTOR (mammalian target of rapamycin) inhibitor. It is commonly used as a laboratory reagent and research tool.
Automatically generated - may contain errors
Lab products found in correlation
Rt2 first strand kit, by Qiagen (1 mentions)
Fetal bovine serum (fbs), by Sartorius (1 mentions)
Bcl 2, by Abcam (1 mentions)
Trem2, by Abcam (1 mentions)
Alexa fluor 790, by Abcam (1 mentions)
Rpmi 1640, by Sartorius (1 mentions)
Sybr green qpcr mastermix, by Qiagen (1 mentions)
Dapi 4 6 diamidino 2 phenylindole, by Beyotime (1 mentions)
Bortezomib, by Selleck Chemicals (1 mentions)
Cleaved caspase 3, by Cell Signaling Technology (1 mentions)
Total akt, by Cell Signaling Technology (1 mentions)
Cleaved parp, by Cell Signaling Technology (1 mentions)
Lipofectamine reagent, by Thermo Fisher Scientific (1 mentions)
Ecl plus kit, by GE Healthcare (1 mentions)
Wortmannin, by Selleck Chemicals (1 mentions)
Hrp conjugated anti mouse or anti rabbit secondary antibodies, by GE Healthcare (1 mentions)
Phospho akt s473, by Cell Signaling Technology (1 mentions)
Nvp bez235, by LC Laboratories (1 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
Penicillin streptomycin, by Merck Group (1 mentions)
7 protocols using rapamycin sirolimus
1
Investigating Autophagy and Inflammation Pathways
2
Molecular Mechanisms of PI3K/Akt/mTOR Pathway
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bortezomib was kindly provided by Xian-Janssen Pharmaceutical Ltd. Rapamycin (Sirolimus) was purchased from Selleck Chemicals LLC (Houston, TX, USA). 8-ethoxy-2-(4-fluorophenyl)-3-nitro-2H-chromene (S14161) was kind provided by Dr. Mao (Cyrus Tang Hematology Center, Soochow University, Suzhou, Jiangsu, China) [26 (link)]. Other chemicals were purchased from Sigma Company (Saint Louis, MO), unless specifically annotated. PI3K/Akt/mTOR pathway related primary antibodies were purchased from Abcam (Cambridge, MA, USA), and others primary antibodies were purchased from Cell Signaling Technology (Danvers, MA, USA).
3
Molecular Mechanisms of Chemotherapeutic Agents
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primary antibodies against p53, Phospho-Akt(S473), total-AKT, PUMA, cleaved PARP, Ki67, and cleaved Caspase3 were purchased from cell signaling; alpha-tubulin antibody was from Santa Cruz Technologies. Lipofectamine™ Reagent was purchased from Invitrogen. HRP-conjugated anti-rabbit or anti-mouse secondary antibodies and an ECL-plus kit were from GE Healthcare. 5-FU was purchased from APP Pharmaceuticals and NVP-BEZ235 was purchased from LC Laboratories. The plasmid of expressing PUMA was kindly supplied by Jian Yu, Ph.D. [9 (link)]. The oligonucleotide for shFOXO3a was synthesized as 5′-CACCGACTCCGGGTCCAGCTCCACTTCAAGAGAGTGGAGCTGGACCCGGAGTTTT TTTG-3′. NVP-BBD130 was purchased from Axon Medchem. Wortmannin and Rapamycin (Sirolimus) were purchased from Selleck Chemicals. Other chemicals were mainly from Sigma.
4
Cell Culture and Gene Silencing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TPC1 cells and BCPAP cells were cultured in DMEM/F-12 medium (Gibco, Thermo Fisher Scientific) supplemented with 2 mM glutamine, 10% fetal bovine serum (Gibco, Thermo Fisher Scientific), and 100 U/ml penicillin/streptomycin (Sigma, St. Louis, MO, United States). The cells were maintained at 37°C in a humidified atmosphere containing 5% CO2. Rapamycin (Sirolimus) was purchased from Selleck (Shanghai, China).
The siRNAs of ENO1 and CST1 were purchased from GenePharma. siCtrl: 5′-UUCUCCGAACGUGUCACGU-3′; siENO1#1: 5′-CGUACCGCUUCCUUAGAACUU-3′; siENO1 #2:5′-GAAUGUCAUCAAGGAGAAAUA-3′; siCST1#1:5′-CC ACCAAAGAUGACUACUA-3′; siCST1#2:5′-GCUCUUUCGAG AUCUACGA-3′; siCST4#1:5′-CUUUCGAGAUCUACGAAGU UCTT-3′; siCST1#2:5′-CCAUCAGCGAGUACAACAATT-3′. According to the manufacturer’s protocol, Lipofectamine RNAiMAX transfection reagent (Invitrogen; Thermo Fisher Scientific) was used for transfection of siRNA. Lipofectamine 3000 (Thermo Fisher Scientific) was used for plasmid overexpression.
The siRNAs of ENO1 and CST1 were purchased from GenePharma. siCtrl: 5′-UUCUCCGAACGUGUCACGU-3′; siENO1#1: 5′-CGUACCGCUUCCUUAGAACUU-3′; siENO1 #2:5′-GAAUGUCAUCAAGGAGAAAUA-3′; siCST1#1:5′-CC ACCAAAGAUGACUACUA-3′; siCST1#2:5′-GCUCUUUCGAG AUCUACGA-3′; siCST4#1:5′-CUUUCGAGAUCUACGAAGU UCTT-3′; siCST1#2:5′-CCAUCAGCGAGUACAACAATT-3′. According to the manufacturer’s protocol, Lipofectamine RNAiMAX transfection reagent (Invitrogen; Thermo Fisher Scientific) was used for transfection of siRNA. Lipofectamine 3000 (Thermo Fisher Scientific) was used for plasmid overexpression.
5
Antibodies for Autophagy Pathway Study
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Antibodies used in this experiment included the following items: anti-RND2 (13844-1-AP, Proteintech, USA), anti-Rho7 /Rnd2 (GXT56070, from GeneTex in USA), anti-p-p38(#4511, from Cell Signaling Technology in USA), anti-p38 (#9212, from Cell Signaling Technology in USA), anti-cleaved-caspase3 (ab32042, from Abcam in UK), anti-caspase3 (NB100-56708SS, from Novus in USA), anti-Bax (50599-2-Ig, from Proteintech in USA), anti-GAPDH (#5174, from Cell Signaling Technology), anti-SQSTM1/P62 (M162-3, from Medical Biological Laboratories in Japan), anti-Beclin1 (11306-1-AP, from Proteintech in USA), anti-LC3B (GB11124, from Servicebio in China), USA), anti-DYKDDDK/Flag-tag (ANT102, from Antgene in China), and anti-His-tag (D291-3, from Medical Biological Laboratories in Japan). Autophagy inhibitor Wortmannin (3-MA) and the autophagy activator Rapamycin (Sirolimus) (S1039, from USA) were bought from Selleck (S2758, USA).
6
PI3K Pathway Drug Response Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To test the effect of drug treatment on protein and phosphoprotein levels, cell lines were dosed with drugs focused on the PI3K pathway including buparlisib (BKM-120, Selleck Chemicals), alpelisib (BYL-719, Selleck chemicals), IPI-549 (Selleck Chemicals), sirolimus (rapamycin, Selleck Chemicals), and ipatasertib (GDC-0068, Selleck Chemicals). To determine dosing for imaging-based experiments, all drugs were screened against each cell line to determine IC50 values via conventional cell viability assay (MTT). Treatments were administered at 80% of the IC50 dosing overnight prior to fixation for cell line treatments (Fig. 5b , Supplementary Fig. 10 ).
7
Miransertib and Sirolimus Preparation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ArQule, Inc. (a wholly owned subsidiary of Merck & Co., Inc.) provided miransertib (ARQ 092) and MK-4440. Miransertib and dactolisib were also purchased from MedChemExpress. For in vitro studies, both compounds were dissolved to 30 mM in DMSO and stored at -20°C protected from light. Sirolimus (rapamycin) was purchased from Selleckchem, dissolved to 10 mM in DMSO, and stored at -80°C. For the in vivo studies, twice per week, miransertib was dissolved to 10 mg/ml in 0.01 M phosphoric acid (pH 2.2) and protected from light. Sirolimus was dissolved to 10 mg/ml in 100% ethanol and further diluted on the day of administration to equal parts of 20% PEG-400 and 20% Tween-80 in water (23 (link)).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!