Total RNA was extracted from fresh tissues collected at different growth stages using the EASYspin Plus Complex Plant RNA Kit (Aidlab, Beijing, China). First-strand cDNA was synthesized with the AMV First-Strand cDNA Synthesis Kit (Sangon Biotech, Shanghai, China).
Gel imaging system
The Gel imaging system is a laboratory equipment used for the visualization and analysis of DNA, RNA, or protein samples separated by gel electrophoresis. It captures and digitizes images of stained gels, enabling researchers to document and quantify the results of their experiments.
Lab products found in correlation
21 protocols using gel imaging system
Genomic DNA and Total RNA Extraction
Total RNA was extracted from fresh tissues collected at different growth stages using the EASYspin Plus Complex Plant RNA Kit (Aidlab, Beijing, China). First-strand cDNA was synthesized with the AMV First-Strand cDNA Synthesis Kit (Sangon Biotech, Shanghai, China).
Quantitative Protein Expression Analysis
SRAP Analysis of Genetic Diversity
Primers used in the present study
Process | Primers name | Sequence | Primers name | Sequence |
---|---|---|---|---|
SRAP | F1 | TGAGTCCAAACCGGATA | R3 | GACTGCGTACGAATTGAC |
F2 | TGAGTCCAAACCGGAGC | R4 | GACTGCGTACGAATTTGA | |
F5 | TGAGTCCAAACCGGAAG | R7 | GACTGCGTACGAATTCAA | |
R8 | GACTGCGTACGAATTAGC | |||
16S rRNA gene | 16S-F | AGAGTTTGATCATGGCTCAG | 16S-R | GGTACCTTGTTACGACTT |
Western Blot Analysis of Apoptosis Markers
Bacterial Membrane Protein Extraction
Quantification of HIF-1α and ISCU Proteins
High-Throughput Screening of HaTRPA1 Variants
Quantitative Western Blot Analysis
Characterization of CS-g-PEI/pDNA Polyplexes
To investigate the binding affinity of CS-g-PEI copolymers to pDNA, the CS-g-PEI/pDNA polyplexes with different N/P ratios were loaded on a 1% agarose gel with Tris-acetate (TAE) running buffer and subjected to electrophoresis at 90 V and 50 mA for 60 min (0.1 mg of pDNA per hole, the N/P ratio varying from 1 to 6). The fluorescence of the intercalated dye (ethidium bromide) was measured using a gel imaging system (Syngene, UK). To evaluate the stability of the polyplexes in serum, the freshly prepared polyplex (at the N/P ratio of 6) solutions and FBS solutions were mixed in Eppendorf tubes. After incubating at 37°C for 30 min, the stability of the polyplexes in serum was evaluated by electrophoresis.
Hydration particle size and ζ-potential of the polyplexes were measured in triplicate on a dynamic light scattering (DLS, Nano ZS 90, Malvern, UK) with 90° scattering angles at 25°C. The CS-g-PEI/pDNA polyplexes were prepared in water at the N/P ratio of 6.
Western Blot Protein Analysis Protocol
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!