Peripheral blood mononuclear cells (PBMCs) were isolated using Ficoll-Hypaque density gradient centrifugation (Ficoll-Hypaque; TBDScience, Tianjin, China). Total RNA was extracted from PBMC with TRIzol (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. The first-strand cDNA was synthesized using the Reagent Kit (TaKaRa, Dalian, China). The primers and probes for real-time PCR of IRAK1 were purchased from QuantiFast Probe of Qiagen. The sense and antisense primers of IRAK4 used in this experiment were: sense: 5′TGATGGAGATGACCTCTGCT3′ and antisense: 5′GGTGGAGTACCATCCAAGCAA3′. Real-time quantitative PCR was performed on an AB7500 Fast System (Applied Biosystems). During the course of the project we first tested IRAK1 expression and later also included IRAK4 in a different set of patients and controls.
Ficoll hypaque
Manufactured by TBD Science
Sourced in China
Ficoll-Hypaque is a density gradient medium used for the separation of cells, cellular components, and other biological materials. It is a mixture of sucrose and an inert, high-molecular-weight, hydrophilic polymer. The density of the medium can be adjusted by varying the concentration of the components, allowing for the efficient separation of different cell types or cellular constituents.
Automatically generated - may contain errors
Lab products found in correlation
Trizol, by Thermo Fisher Scientific (1 mentions)
Ab 7500 fast system, by Thermo Fisher Scientific (1 mentions)
Penicillin streptomycin, by Solarbio (1 mentions)
Recombinant human il 1β, by Novoprotein (1 mentions)
Mcc950, by Topscience (1 mentions)
70 μm nylon strainer, by BD (1 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (1 mentions)
Dnase 1, by Roche (1 mentions)
Collagenase a, by Roche (1 mentions)
Dulbecco modified eagle medium (dmem), by BD (1 mentions)
Anti mouse igg microbeads, by Miltenyi Biotec (1 mentions)
Recombinant porcine gm csf, by R&D Systems (1 mentions)
Recombinant porcine il 4, by R&D Systems (1 mentions)
Trizol, by Takara Bio (1 mentions)
Trizol reagent, by Takara Bio (1 mentions)
Iq5 real time pcr instrument, by Bio-Rad (1 mentions)
Sybr green pcr master mix kit, by Takara Bio (1 mentions)
Trypan blue, by Merck Group (1 mentions)
Ts100, by Nikon (1 mentions)
Rpmi 1640 medium, by Thermo Fisher Scientific (1 mentions)
18 protocols using ficoll hypaque
1
PBMC Isolation and IRAK Gene Expression
2
Isolation and Stimulation of PBMCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human PBMCs were freshly isolated from Natrium Citrate-treated blood, and were then isolated by Ficoll-Hypaque (TBD science, cat#LDS1075) density-gradient centrifugation. Cells were cultivated in RPMI 1640 medium (Hyclone, cat# SH30809101) supplemented with 2 mM L-glutamine, penicillin/streptomycin (Solarbio, cat# P1400), and 10% fetal bovine serum (FBS, Hyclone, cat# SH30809.01) in Teflon bags and allowed to rest for 24 h prior to stimulation. All incubations were performed at 37℃ in humidified air with 5% CO2. PBMCs were stimulated with MSU (100ng/mL) and TLR1/2 stimulator Pam3Cys (10 μg/mL) with or without MCC950 (Topscience, cat#T3701, 5 μM) for 6 h, supernatant and cells were collected for ELISA and RT-PCR. PBMC were cultured with or without recombinant human IL-1β (Novoprotein, cat# 0331537, 5 ng/mL), cells were collected at different time points for RT-PCR.
3
Isolation of Immune Cells from Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Immune cells were isolated from colon tissues, peripheral blood, bone marrow and spleen by flow sorting. Single-cell suspensions from colon tissue dissection were prepared by manual mincing using scalpel followed by enzymatic digestion for 40 min at 37°C by Collagenase A 2.0 mg/mL (Roche, Canada) and DNase I 100U/mL (Roche, Canada) dissolved in DMEM (Gibco, USA) under continuous stirring. Digestion mixtures were resuspended by DMEM containing 10% FBS and then filtered through 70 μm nylon strainers (Falcon, BD biosciences, USA). Immune cells from peripheral blood,bone marrow and spleen were obtained by Ficoll-Hypaque (TBD science, China) density centrifugation 2000 rpm for 20 min.
4
Isolation and Differentiation of Porcine CD14+ Monocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Peripheral blood samples were collected into 50 mL centrifuge tubes with 0.5% heparin sodium, diluted in a ratio of 1:2 with sterile 1×PBS, overlaid on Ficoll-Hypaque (TBD science, Tianjin, China) and PBMCs were collected as previously detailed [32 (link)]. CD14+ monocytes were purified from PBMCs by immunomagnetic labeling of cells using mouse anti-pig CD14 monoclonal antibody (AbD Serotec, Raleigh, NC, USA) and anti-mouse IgG MicroBeads (Miltenyi Biotec, Bergisch-Gladbach, Germany) according to the manufacturer’s protocol. The CD14+ monocytes were cultured for 5 days in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS), 25 ng/mL recombinant porcine IL-4 and 10 ng/ml recombinant porcine GM-CSF (R&D systems, Minneapolis, MN, USA). The cell culture medium was replenished every 3 days. The typical veiled morphology of the cells was checked for every day. After five days of culture, CD1, SLA-II, and CD172a markers on these cells were analyzed by flow cytometry using monoclonal antibodies [33 (link), 34 (link)].
5
PBMC Isolation from Pemphigus Patients
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A total of six ml venous blood was extracted from the pemphigus patients and healthy subjects. PBMC were isolated by Ficoll-Hypaque (TBD Science, Tianjing, Chian) density gradient centrifugation, lysed in TRIzol (Takara Bio, Kusatsu, Japan) and stored at −80 °C until use.
6
Gene Expression Analysis in AML
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mononuclear cells (MNC) were separated from the bone marrow (BM) of AML patients at the time of initial diagnosis by Ficoll-Hypaque (TBD Science, Tianjin,China) density gradient centrifugation. RNA was extracted using the TRIzol reagent (Takara, Japan) and was reverse transcribed with PrimerSctipt RT agent Kit (Takara, Japan). Quantitative assessments of cDNA amplification for PARP-1, BRCA1 and GAPDH were performed in triplicate using SYBR-Green PCR Master Mix kit (Takara, Japan) on an IQ5 real time PCR instrument (Bio-Rad, Hercules, CA). The primers sequences were as follows: PARP-1 5′-TCT GAG CTT CGG TGG GAT GA-3′ (forward) and 5′-TTG GCA TAC TCT GCT GCA AAG-3′ (reverse); BRCA1 5′-GAA ACC GTG CCA AAA GAC TTC-3′ (forward) and 5′-CCA AGG TTA GAG AGT TGG ACA C-3′ (reverse); GAPDH 5′-ACC ACC CTG TTG CTG TAG CCA A-3′ (forward) and 5′-GTC TCC TCT GAC TTC AAC AGC G-3′ (reverse).
7
Isolation of Bovine PBMCs via Ficoll Gradient
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PBMCs were prepared with Ficoll gradient centrifugation. Briefly, 10 mL of Ficoll-Hypaque (TBDscience, China) was stratified under 10 mL of diluted peripheral blood (anticoagulated blood mixed with an equal volume of phosphate-buffered saline [PBS]) and centrifuged at 400 ×g for 20 min at 22℃ according to the manufacturer's instructions. The recovered PBMCs were washed three times with cell culture medium, after which the samples were stained with Trypan blue (Sigma-Aldrich, USA) at a concentration of 0.4 mg/mL and the living cells were counted under a microscope (400×, TS-100; Nikon, Japan). Freshly isolated bovine PBMCs were used for all subsequent experiments.
8
Isolation and Purification of CD8+ T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Splenic lymphocytes were isolated from splenic cell suspension using density gradient centrifugation (Ficoll-Hypaque, TBD Science, Tianjin, China). CD8+ T lymphocytes were purified using microbead isolation kits followed by magnetic-activated cell sorting (MACS) according to the manufacturer’s instructions (Miltenyi Biotec, Germany). Isolated cells were resuspended at a concentration of 1 × 106 cells/mL in RPMI-1640 medium (Thermo Fisher Scientific, USA) containing L-glutamine (2 mM), penicillin/streptomycin (100 U/mL), and 10% fetal calf serum (Thermo Fisher Scientific, Waltham, MA, USA).
9
PBMC Isolation from Venous Blood
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A volume of 5 ml of venous blood was obtained from the patients and controls, and plasma samples were prepared. PBMCs were isolated by Ficoll-Hypaque (TBD Science, Tianjin, China) density gradient centrifugation, lysed in Mix RNAiso blood buffer (Takara Bio, Inc., Otsu, Japan) and stored at −80°C until use.
10
Isolation and Differentiation of Macrophages
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
First, peripheral blood mononuclear cells (PBMCs) were isolated by Ficoll-Hypaque (1.077 g) (LTS1077, tbdscience, Tianjin, China). Then, CD14+ cells were isolated from the PBMCs by performing CD14 bead positive selection (Miltenyi Biotech) according to the manufacturer’s instructions. After confirming the purity of CD14+ monocytes by flow cytometry, the cells were cultured in 6-well plates at 5 × 105 cells/ml in 10% FBS-RPMI 1640 and differentiated into macrophages by incubation with 50 ng/ml phorbol 12-myristate 13-acetate (PMA) for 24 h.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!