Sh mettl14

Specific short hairpin RNA (shRNA) constructs targeting METTL14 (sh-METTL14) and FTH1 (sh-FTH1), overexpression plasmids for METTL14 (pcDNA-METTL14) and FTH1 (pcDNA-FTH1), and their corresponding negative controls (sh-NC, pcDNA-NC), were obtained from GenePharma (Shanghai, China). Additionally, sequences representing wild-type METTL14 (WT-METTL14) and mutant METTL14 (MUT-METTL14) were amplified using cDNA as a template and subsequently cloned into the pGL6 vector. The transfection of these plasmids into cells was performed using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s instructions. Cells were harvested 48 hours post-transfection to determine transfection efficiency or for subsequent analyses.

Lentiviral sh-METTL14, sh-UBR1, sh-YTHDF1, sh-YTHDF2, and/or NCS (GenePharma) were transfected into PC12 cells. The cells were treated with TBHP for 48 h after transfection. The lentiviruses were generated. Specifically, the overexpression (LV-UBR1) or silencing (sh-UBR1: UUGUACAUUCUCUUCUUGCUU; sh-METTL14: AAGUUUCUCUUGUUUCAGCGA; sh-YTHDF1: UUAUUCUCUUGUCCUUUUGUU; sh-YTHDF2: UCAAGUAAGGUUCGAAAUCAU) sequences of the target genes were designed and synthesized. Subsequently, the amplified sequences were inserted into lentiviral vectors (LV6 was used as the overexpression vector and LV-1 as the knock-down vector), and positive clones were confirmed by sequencing to obtain recombinant plasmids. Tool vector plasmids carrying target genes and helper plasmids (for lentivirus packaging) were transfected into 293T cells by GenePharma and cultured for 6 h. The medium was then replaced with complete medium. Seventy-two hours later, cell supernatants were collected, purified, and condensed. The acquired liquid was subjected to a viral titer test at 10⁸ TU/ml.

short hairpin RNA (Sh)-METTL14, sh-YTHDF1, sh-YTHDF2, sh-YTHDC1, sh-IGF2BP1, sh-IGF2BP2, sh-IGF2BP3, sh-NC, empty vector, and SMAD1 overexpression vector, IGF2BP1 overexpression vector, and IGF2BP2 overexpression vector were obtained from Genepharma. BMSCs were seeded into 6-well plates and transfected with sh-METTL14 and sh-NC using Lipofectamine 3000 (Invitrogen, Carlsbad) for 48 h.