Anti v5

hOAS1 proteins expressed in bacteria or in mammalian cells were separated on a 10% SDS-PAGE gel and transferred to a nitrocellulose membrane at 100 V for 1 h. The membrane was incubated in blocking buffer (1 X Tris-buffered saline containing 5% non-fat dry milk and 0.1% Tween 20) at room temperature for 1 h and then cut into strips. To detect the hOAS1 isoform proteins expressed in bacteria, the membrane strips were incubated with anti-V5 (Sigma-Aldrich, St. Louis, MO, USA; 1:1000) antibody at 4 °C overnight. To detect overexpressed hOAS1 isoforms in HEK293 cell lysates, the membrane strips were incubated at 4 °C overnight with mouse anti-Flag antibody (Sigma-Aldrich, St. Louis, MO, USA; 1:1000) or mouse anti-β actin antibody (Cell signaling, Danvers, MA, USA; 1: 10,000). The membranes were washed three times for 10 min with 1 X Tris-buffered saline containing 0.1% Tween 20, and then incubated with a horseradish peroxidase-conjugated secondary antibody (Santa Cruz Biotechnology, Dallas, TX, USA) for 1 h at room temperature. After washing, the membrane strips were processed for enhanced chemiluminescence using a Super-Signal West Pico detection kit (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s protocol.

Kc167 cells were collected, washed in PBS and incubated for 30 min in IP buffer (150 mM NaCl, 0.5% NP40, 50 mM Tris-HCl, pH8.0, 1mM EGTA) supplemented with protease inhibitor cocktail (Roche). The extracts were cleared by centrifugation at 13.000g for 15 min at 4°C and subjected to SDS-PAGE (50 μg of proteins par lane) or immunoprecipitation (1 mg per point). For immunoprecipitation, proteins were preadsorbed with 100 μl of sepharose beads slurry for 1h at 4°C before being incubated with 20 μl of anti-GFP (Chromotek), anti-V5 (Sigma-Aldrich) or anti-HA (Covance) antibody coupled to sepharose beads, or with 10 μl of rabbit anti-MLF [19 (link)] or rabbit IgG (SantaCruz) in the presence of 20 μl of protein A sepharose beads (Sigma), for 4h at 4°C. The beads were spun down and washed in IP buffer and immunoprecipitated proteins were processed for SDS-PAGE and Western Blot analyses. Western blots were performed using standard techniques and the blots were developed by photoluminescence procedure using Lumi-Light^PLUS Western Blotting Substrate (Roche) and Amersham Hyperfilm^TM ECL (GE Healthcare) or Chemidoc Touch Imaging System (BioRad). The following antibodies were used for Western blots: anti-V5 (Invitrogen), anti-HA (BioLegend), anti-GFP, anti-tubulin (Sigma-Aldrich), anti-Renilla luciferase (MBL), and anti-MLF [19 (link)].

For preparation of ChIP, dispensed cells were formalin fixed, lysed, and sonicated to break the chromatin into 500–800 bp fragments, followed by immunoprecipitation. Anti-H3K4me2 (Milipore) and anti-V5 (Sigma) are used for immunoprecipitation. The qPCR analysis was carried out using the SYBR Green method. The primers are listed as following: PIK3R1-enh: forward, 5′-GTGGAAGAACAGCTTTGGGG-3′, reverse, 5′-TCAAGGCAACTTACTTTGCAGG-3′. PIK3R1-LBS: forward, 5′- TTGTTGATTTCCCCACCCCTC-3′, reverse, 5′- TCCCAAGCTGGGCTCTATTTG -3′.

Cells were lysed in EBC buffer (50 mM Tris pH 8.0, 120 mM NaCl, 1 mM EDTA, 0.5% NP40) containing 1 mM phenylmethylsulfonyl fluoride, 20 U/ml aprotinin, 1 µM leupeptin, 1 mM dithiothreitol, 0.1 mM NaF, 0.1 mM sodium orthovanadate, and 10 mM β-glycerophosphate. Proteins were resolved by SDS-PAGE, transferred to the membrane, and immunoblotted with the indicated antibodies: Fbxl8 (Santa Cruz Cat# sc-390582), Fbxw7 (Bethyl Laboratories Cat# A301-720A), c-myc (Cell Signaling Cat# 9402S), Cyclin D3 (Cell Signaling DCS22), Actin (Sigma Cat# A5316), vinculin (Cell Signaling Cat# 4650S), Alpha Tubulin (Sell Signaling Cat# 2144S) Anti-Flag (Sigma Cat#F7425-.2 MG), and anti-V5 (Sigma Cat#V8137-.2 MG). Proteins of interest were detected with horseradish peroxidase-conjugated antimouse or rabbit antibodies, and signals were visualized with the ECL system (Perkin Elmer Cat# NEL105001EA).