Plasmids containing cDNA of CD44 protein were synthesized by GENECHEM, Shanghai, China. Using Pfu polymerase and two oligonucleotides (TCCGCTCGAGATGGACAAGTTTTGGTGGCACG and ATCGGAATTCTTACACCCCAATCTTCATGTC), the CD44 cDNA was cloned into Xhol and ECOR1 sites of GV146 (GENECHEM, Shanghai, China) by recombinant PCR. Then, CD44-negative MNK-28 cells were transfected with the plasmid with Lipofectamine 2000 reagent (Invitrogen, California, USA), and then the efficiency of CD44 expression in MKN-28 cells was tested. Finally, two cell lines were generated as following: MKN-28-con with no CD44 expression and MKN-28-CD44-ox with CD44 overexpression labeled with enhanced green fluorescent protein (EGFP).
Gv146
Manufactured by Genechem
Sourced in China
The GV146 is a piece of laboratory equipment designed for analytical purposes. It is a multi-purpose instrument that can perform a variety of tasks in scientific research and testing environments. The core function of the GV146 is to provide accurate and reliable data analysis capabilities to support various laboratory applications. Detailed technical specifications and intended use cases are not available.
Automatically generated - may contain errors
Lab products found in correlation
0.45 mm lters, by Merck Group (2 mentions)
Plv h1 ef1α puro, by Biosettia (2 mentions)
Lipofectamine 2000 reagent, by Thermo Fisher Scientific (1 mentions)
Gv238, by Genechem (1 mentions)
Pegfp n1 vector, by Takara Bio (1 mentions)
Q5 site directed mutagenesis kit, by New England Biolabs (1 mentions)
Endofree maxi plasmid kit, by Tiangen Biotech (1 mentions)
4 protocols using gv146
1
Generating CD44-Overexpressing Cell Lines
2
FOXI3 Overexpression and Mutagenesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The entire coding sequence of FOXI3 was cloned into the pIRES2-EGFP eukaryotic overexpression vector (GV146, Genechem Co., Ltd., Shanghai, China). The mutants of FOXI3 were generated using the Q5 Site-Directed Mutagenesis Kit (E0554, New England BioLabs, Beverly, MA, USA) and verified by Sanger sequencing. The AE4 promoter sequence was cloned into the luciferase vector (GV238, Genechem Co., Ltd., Shanghai, China). The wild type and mutant variants of FOXI3 were cloned into the pEGFP-N1 vector (Clontech Laboratories, Inc., Palo Alto, CA, USA) to construct a C-terminus EGFP fused FOXI3 expression vector, respectively. Endotoxin-free plasmid was prepared using EndoFree Maxi Plasmid Kit (4992194, Tiangen, Shanghai, China) according to the manufacturer’s instructions.
3
Overexpression and Knockdown of ZEB1 in MDA-MB-231 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human complementary DNA fragment encoding full-length ZEB1 was cloned into GV146 (Shanghai Gene chem, China), and the vector was transfected to MDA-MB-231 cells for 48 h to over-express ZEB1. The lentiviral-based vector pLV-H1-EF1α-puro (Biosettia, San Diego, USA) was used to express shRNA in MDA-MB-231 cells. Lentiviruses were generated by transfecting subcon uent HEK293T cells with lentiviral vectors and packaging plasmids by calcium phosphate transfection. Viral supernatants were collected after 48 h following transfection, centrifuged and ltered through 0.45-mm lters (Millipore, MA, USA).
4
Overexpression and Knockdown of ZEB1 in MDA-MB-231 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human complementary DNA fragment encoding full-length ZEB1 was cloned into GV146 (Shanghai Gene chem, China), and the vector was transfected to MDA-MB-231 cells for 48 h to over-express ZEB1. The lentiviral-based vector pLV-H1-EF1α-puro (Biosettia, San Diego, USA) was used to express shRNA in MDA-MB-231 cells. Lentiviruses were generated by transfecting subcon uent HEK293T cells with lentiviral vectors and packaging plasmids by calcium phosphate transfection. Viral supernatants were collected after 48 h following transfection, centrifuged and ltered through 0.45-mm lters (Millipore, MA, USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!