Total rna purification kit

The level of NRF2 expression was assayed by a quantitative real-time polymerase chain reaction. First, the extraction of total RNA was done using total RNA purification kit according to the manufacturer’s protocol (Thermo Scientific, USA). The extracted RNA analyzed for quantity and quality (A260/A280) and it was then used for cDNA synthesis using QuantiTect reverse transcription (QIAGEN, Germany). After that, the amplification of synthesized cDNA was performed by Maxima SYBR Green/ROX qPCR Master Mix (2X) following the manufacturer’s protocol (Thermo Scientific, USA). The first denaturation step of the PCR cycle was performed at 95 °C for 10 min. Then, using a PCR equipment (QIAGEN, rotor gene 5 plex), 40 denaturation cycles at 95 °C for 15 s, followed by 30 s of annealing at 60 °C, and 30 s of elongation at 72 °C. The housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), was used as a normalizer for the target gene expression, which was represented as a fold change in relation to the calibrator, using the 2^−∆∆Ct method (Livak and Schmittgen 2001 (link)). The used primer sequences were NRF2 5-GAGACGGCCATGACTGAT-3(forward), 5–GTGAGGGGATCGATGAGTAA–3(reverse). GADPH 5–AGGTTGTCTCCTGTGACTTC–3(forward), and 5–CTGTTGCTGTAGCCATATTC–3(reverse) (Ueda et al. 2008 (link)).

TGF-β1 and MCP-1 gene expression was evaluated using reverse transcription-polymerase chain reaction (RT-PCR). In brief, pure RNA was extracted using a total RNA Purification Kit according to the manufacturer’s protocol (Thermo Scientific, Fermentas, #K0731). A high capacity cDNA reverse transcription kit was utilized to convert the total RNA (0.5 to 2 µg) to cDNA. The cDNA samples were then stored at −20 °C. The isolated cDNA was amplified using 2X Maxima SYBR Green/ROX qPCR Master Mix following the manufacturer’s protocol (Thermo Scientific, Waltham, MA, USA). The qRT-PCR assay with the following gene-specific primer sets was optimized with the annealing temperature (MCP-1; forward primer: GCAGCAGGTGTCCCAAAGAA, reverse primer: ATTTACGGGTCAACTTCACATTCAA, TGF-β1; forward primer: GCAACATGTGGAACTCTACCAGA, reverse primer: GACG TCAAAAGACAGCCACTCA, β-actin; forward primer: ACTATTGGCAACGAGCGGTT, reverse primer: CAGGATTCCATACCCAAGAAGGA). Real-time PCR amplification and analysis were performed to measure the expression of mRNAs of target genes in the tissue relative to β-actin mRNA expression as an internal reference.

Total RNA was isolated using the Norgen Biotek Total RNA purification kit, treated with DNase I, and reverse-transcribed using the Verso cDNA Synthesis Kit (Thermo Fisher). The number of mRNA copies normalized to rpL32 mRNA was quantified in triplicate reactions in a 7300 Real-Time PCR System using the TaqMan Universal PCR MasterMix (Applied Biosystems)^{21 (link)}. Gene accession numbers and primer and probe sequences are listed in Table S1.

Total RNA was isolated from blood samples using RNAprep Pure Blood Kit (Tiangen Biotech, Beijing, China). Total RNA was extracted from the cell lines using a Total RNA Purification kit (Invitrogen) in accordance with the manufacturer’s protocols. After the assessment of quantity and concentration of RNA, total RNA was used for the reverse transcription reaction with the Prime-Script RT reagent kit (TaKaRa, Dalian, China). Quantitative RT-PCR was performed using an miScript SYBR green PCR kit (Qiagen, Hilden, Germany). The relative mRNA level of TRIM31 was calculated using the comparative 2^−ΔΔC_t method.

Total RNA was isolated from Hela cells using a total RNA purification kit (Invitrogen,USA). Reverse transcription (RT) of the mRNA was carried out by First Strand cDNA Synthesis Kit (Bio-rad, USA) using random primers with conditions of 25°C for 5min; 42°C for 30min and 85°C for 5min.The real-time PCR was performed with the FastStart Universal SYBR Green Master Mix (Roche, USA). The 19μL reaction mixture with 1μL cDNA was first denatured at 95°C for 5 min and then 40 cycles of PCR were performed using the following protocol: 95°C 30 s; 60°C 30 s; 72°C 30 s in 20μl reaction volume. mRNA levels of IFNα, IFNß, TLR3, RIG-I and ISGs including: IFN-induced ubiquitin-like protein (ISG15), myxovirus resistance A (MxA), 2’,5’-oligoadenylatesynthetase3 (OAS3) were determined by real-time quantitative PCR. The housekeeping geneglyceraldehydes-3-phosphate dehydrogenase (GAPDH) was chosen as reference gene to quantify the level of mRNA expression. The primers used for real-time quantitative PCR in this study were listed in Table 1.

IWR-1 was obtained from ENZO (Farmingdale, NY, USA), PI3K inhibitor LY294002 was purchased from Sigma-Aldrich (St Louis, MO, USA), and recombinant human tumor necrosis factor (TNF)-α was from R&D Systems (Minneapolis, MN, USA). Primary antibodies against E-cadherin, N-cadherin, Snail, Survivin, Vimentin, p-Akt (Ser473), t-Akt, β-catenin, and β-Actin as well as secondary antibodies conjugated to horseradish peroxidase (HRP), Alexa-594, and FITC were obtained from Cell Signaling Technology (Danvers, MA, USA). Lipofectamine 2000, SYBR Green, and the total RNA purification kit were purchased from Invitrogen (Carlsbad, CA, USA), and the RT-Premix Kit was obtained from ELPIS Biotech (Daejeon, South Korea).