Cells were grown essentially as described in ref. (32 (link)). 293T cells were cultured in Dulbecco’s modified Eagle’s medium (Lonza, Breda, The Netherlands) supplemented with 10% fetal bovine serum (Greiner), 1% nonessential aas (NEAAs) (Lonza), 1 mM sodium pyruvate (Gibco), 2 mM glutamine (L-glu, Lonza), 100 IU/mL penicillin (PEN) (Lonza), and 100 μg/mL streptomycin (STR) (Lonza). Madin–Darby canine kidney (MDCK) cells were cultured in Eagle’s minimal essential medium (Lonza) supplemented with 10% fetal calf serum, 1% NEAAs, 1.5 mg/mL sodium bicarbonate (Lonza), 10 mM Hepes (Lonza), 2 mM glutamine, 100 IU/mL PEN, and 100 μg/mL STR.
Eagle s minimal essential medium
Manufactured by Lonza
Sourced in United States
Eagle's minimal essential medium is a cell culture medium used to support the growth and maintenance of various mammalian cell lines. It provides a balanced mixture of amino acids, vitamins, and other essential nutrients required for cellular proliferation and viability.
Automatically generated - may contain errors
Lab products found in correlation
Hepes, by Lonza (2 mentions)
Sodium bicarbonate, by Lonza (2 mentions)
Fetal calf serum (fcs), by Lonza (2 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (2 mentions)
Fetal bovine serum (fbs), by Merck Group (2 mentions)
Sodium pyruvate, by Thermo Fisher Scientific (1 mentions)
L glu, by Lonza (1 mentions)
Penicillin pen, by Lonza (1 mentions)
Streptomycin str, by Lonza (1 mentions)
Fetal bovine serum (fbs), by Lonza (1 mentions)
Dulbecco s modified eagle s medium, by Lonza (1 mentions)
Rpmi 1640 medium, by Lonza (1 mentions)
Dulbecco s modified eagle medium, by Lonza (1 mentions)
3 4 5 dimethylthiazol 2 yl 2 5 diphenyltetrazolium bromide mtt dimethyl sulfoxide dmso, by Merck Group (1 mentions)
Glutamine, by Merck Group (1 mentions)
Non essential amino acids (neaa), by Merck Group (1 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (1 mentions)
Etanercept enbrel, by Pfizer (1 mentions)
Collagen 1, by Thermo Fisher Scientific (1 mentions)
Z vad fmk, by Abcam (1 mentions)
15 protocols using eagle s minimal essential medium
1
Culture Conditions for 293T and MDCK Cells
2
Cell Culture Conditions for Diverse Cancer Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All cell lines were obtained from American Type Culture Collection except HT29 (colon adenocarcinoma) which was obtained from Dr. Ranjana Bird at UNBC. All cells were maintained in Eagle’s Minimal Essential Medium (Lonza) except the following: MiaPaca-2 and Panc-1 were maintained in Dulbecco’s Modified Eagle Medium (Lonza), while K562, KG1a and CEM were maintained in RPMI 1640 medium (Lonza). All media were supplemented with 10% fetal bovine serum (Life Technologies Inc.) and antibiotics.
3
3D Collagen Matrix for hs2dAb Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were embedded in a 3D matrix constituted of collagen type I (1.5 mg/ml, Corning®) in EMEM (Eagle’s Minimal Essential Medium; 2 ×, Lonza®) at a concentration of 1,5 × 105 cells/ml. Drops (30 μl) were placed for 1 hour upside down at 37 °C to allow solidification of the matrix. The complete medium was then added and hs2dAb expression was induced by doxycycline. 6 hours later, cell morphology was observed under a Nikon inverted microscope and drops were harvested, collagenase I (100 U/mL final concentration, ThermoFisher®) added and cells centrifuged. Pelleted cells were then lysed in RIPA buffer containing phosphatase and protease inhibitors.
4
Characterizing Immortalized Fetal Glial Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Eagle’s Minimal Essential Medium was purchased from LONZA (Walkersville, Maryland, USA). 3-(4,5-dimethylthiazol-2-yl)-2-5 diphenyltetrazolium bromide (MTT), dimethylsulfoxide (DMSO) and the dextran standards (T1, T5, T12, T25, T50, T80, T150, T270, T410) were obtained from Sigma-Aldrich (St. Louis, MO, USA). Fetal bovine serum (FBS) was from Life Technologies Inc. (Waltham, Massachusetts, USA). Sephadex LH-20 resin, DEAE-Sephadex, and HiPrep 26/60 Sephacryl S-500 HR pre-packed column were purchased from Cytiva (Marlborough, MA, USA). HPLC BioSEC-3 column and guard column were purchased from Agilent (Santa Clara, CA, USA). Immortalized human fetal glial cell line SVG was a gift from Dr. Eugene O. Major, NINDS, National Institute of Health, Bethesda, Maryland, USA15 (link),16 (link). All cell lines were from the American Type Culture Collection. All cells were maintained in Eagle’s Minimal Essential Medium except the following: Panc-1 was maintained in Dulbecco’s Modified Eagle Medium (LONZA). Yeast β–glucan was from Neogen (Lansing, Michigan, USA).
5
Evaluating BRSV Infectivity in Swabs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
BRSV infectivity was tested in ten swabs showing the highest level of viral RNA by RT-ddPCR; eight swabs from coats and two from human nostrils, collected 24 h and 30 min after exposure, respectively. Fetal bovine turbinate cells (courtesy of Swedish Veterinary Institute) propagated in Eagle’s minimal essential medium (BioWhittaker, Belgium) in 96 well plates were incubated with 50 μl filtered swab samples for 30 min. Medium with 2% FCS was added, the plates were incubated at 37 °C in 5% CO2 and the supernatant passaged after seven days. Samples were cultivated in duplicates with positive (cultivated BRSV from a calf in the experiment) and negative controls (cells only). The cells were observed for cytopathic effect (CPE) and infection visualized by direct immunofluorescence test using FITC Moab a-BRSV (Bio-X Diagnostics, Rochefort, Belgium). Culture supernatants were harvested and tested by the BRSV RT-ddPCR as described.
6
Caco-2 Cell Culture Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In a humidified incubator, authenticated Caco-2 cells were grown in Eagle’s minimal essential medium (Lonza) containing 10% fetal bovine serum (Sigma), 1% nonessential amino acids (Sigma), 2 mM glutamine (Sigma), and 100 μg/ml of penicillin-streptomycin (Fisher Scientific) at 37°C with 5% atmospheric CO2.
7
Isolation and Culture of Primary Murine Keratinocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PMKs were obtained from HoipE-KO newborn pups, Tnfr1KO;HoipE-KO and Tnfr1KO;Hoil-1E-KO adult tails according to established protocols64 (link). Briefly, skin was incubated with 0.25% Trypsin in Hank’s Balanced Salt Solution without calcium and magnesium (Stratech Scientific Ltd) overnight at 4 °C. On the following day, the dermis and epidermis were separated. Cell suspensions were cultured in Eagle’s minimal essential medium (Lonza) without calcium with 8% chelate foetal calf serum and penicillin–streptomycin (Sigma). PMKs were seeded in plates pre-coated with collagen I (Life technologies) for subsequent experiments. PMKs were cultured in medium supplemented with 20 µM Z-VAD-fmk (Abcam), 10 µM Necrostatin-1s (Cambridge Bioscience), 1 µM RIPK3 inhibitor (GSK2399872B) or 50 µg mL−1 Etanercept (Enbrel®) (Pfizer and Pentaglobin from Biotest) for 4 days, with supplemented medium replaced every day. On the last day, cell viability was measured using the CellTiter-Glo Luminescent Cell Viability Assay Kit (Promega) following the manufacturer’s instructions. Alternatively, PMKs were treated for 24 h with the following ligands as indicated: 50 ng mL−1 mouse iz-TRAIL, 50 ng mL−1 CD95L-Fc, or 100 µg mL−1 Poly(I:C) (Invitrogen).
8
SARS-CoV-2 Isolation and Identification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Clinical specimens were used to inoculate African green monkey kidney Vero cells (Vero cell, ATCC, CCL-81) for virus isolation. Vero cells were cultured in Eagle's minimal essential medium (Lonza) with 8% heat-inactivated fetal bovine serum (FBS) (Gibco) and antibiotics. The infection of Vero cells with each specimen was carried out in phosphate-buffered saline containing 50 μg/mL DEAE dextran and 2% FBS as previously described [13 (link)]. Cells were monitored daily for 4 days to examine the cytopathic effects. To confirm virus isolation, we performed RT-PCR on supernatants from infected cell cultures using S gene-specific primer sets (forward (5′-3′): AGGGCAAACTGGAAAGATTGCTGA, reverse (5′-3′): TCTGTG CAGTTAACATCCTGATAAAGAAC). Thermal cycling was performed using the following conditions: initial denaturation at 95°C for 3 min and then 35 cycles of 95°C for 30 s, 56°C for 30 s and elongation at 72°C for 40 s, and final elongation step at 72°C for 5 min. All PCR products regardless of whether ferret or human clinical specimens were sequenced and compared with the SARS-CoV-2 reference genome (GISAID accession ID: EPI_ISL_407193). All sequenced-confirmed specimens were considered positive for SARS-CoV-2 infection and used for further study.
9
Culturing Kidney and Lung Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Caki-1 (ATCC, VA USA) and A549 (ATCC) cells were cultured in Eagle’s minimal essential medium (Lonza, Switzerland) supplemented with 10% FBS (Sigma, Germany). Caki-2 cells (Sigma) were cultured in McCoy’s 5A medium (BioWest, MO USA) supplemented with 10% FBS. The RPTEC/TERT1 (ATCC) cell line (passages 7–17) was cultured in DMEM:F12 medium (ATCC) supplemented with the components of the hTERT RPTEC Growth Kit (ATCC) and G418 at a final concentration of 0.1 mg/ml (Sigma).
10
Isolation and Characterization of Duck Aortic Endothelial Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primary duck aortic endothelial cells were isolated and characterized as previously described (25 (link)) and maintained in microvascular endothelial cell growth medium-2 (EGM-2MV; Lonza) on plates coated with 0.2% gelatin (Sigma-Aldrich) at 40°C in 5% CO2. Furin-deficient LoVo cells (CCL-229; ATCC) were maintained in Kaighn's modification of Ham's F-12 medium (Thermo Fisher Scientific) supplemented with 10% fetal calf serum (FCS; Sigma), 100 U/mL penicillin (Lonza), and 100 μg/mL streptomycin (Lonza), at 37°C in 5% CO2. Madin-Darby canine kidney cells (MDCK) were cultured in Eagle’s minimal essential medium (Lonza) supplemented with 10% FCS, 100 U/mL penicillin, 100 U/mL streptomycin, 2 mM l- glutamine (Lonza), 1.5 mg/mL sodium bicarbonate (Lonza), 20 mM HEPES (Lonza), and nonessential amino acids (Lonza) at 37°C in 5% CO2. Duck lung homogenate (dLH) was obtained by digesting freshly isolated lungs of 21-day-old domestic duck embryonated eggs with collagenase and dispase (Roche) followed by treatment with a red blood cell lysis buffer (Roche) for 10 min at room temperature.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!