Cfx manager software 1

For reverse transcriptase quantitative PCR (RT‐qPCR), the total RNA was extracted from PC3 siCA1 and PC3 siMock cells with a NucleoSpin RNA II kit (Macherey‐Nagel, Dueren, Germany). The RNA was depleted from genomic DNA using DNase treatment (DNase I, RNase‐free; Thermo Fisher Scientific, Waltham, MA, USA) and 1.15 µg of total RNA was reverse transcribed with a SensiFAST cDNA Synthesis kit (Bioline, UK). RT‐qPCR was performed in Brilliant III Ultra‐Fast SYBR QPCR Master Mix (Agilent Technologies, USA), 0.25 pmol/µL concentration of primers and 0.5 µL template cDNA in Bio‐Rad 96FX cycler (Bio‐Rad, USA) and analysed using the Bio‐Rad CFX Manager software 1.6 as normalized fold expression (2^−ΔΔCt method). Primer sequences for the CA1 gene and HPRT1 reference gene were as follows:
CA1sense 5′‐TAAAACCAAGGGCAAACGAG‐3′,
CA1antisense 5′‐GGCTGTGTTCTTGAGGAAGG‐3′,
HPRT1sense 5′‐TGACCAGTCAACAGGGGACA‐3′,
HPRT1antisense 5′‐ACTGCCTGACCAAGGAAAGC‐3′.
All oligonucleotides were synthesized by Metabion, Int. (Martinsried, Germany).

Primers for quantitative real-time PCR (qPCR) were based on cat and lynx sequences identified in this study (Table 1). The qPCR was performed using the CFX96 Real-Time PCR Detection System (Bio-Rad Laboratories GmbH, Munich, Germany), as published by Braun et al. [59 (link)]. In brief, diluted ss cDNA (4 μl, corresponding to 2 or 10 ng of total RNA for genes of interest, or 4 ng for reference genes) were analyzed in a 10 μl reaction volume including SsoFast EvaGreen Supermix (Bio-Rad Laboratories GmbH). The qPCR conditions were: 98°C for 2 min and 40 cycles of 8 sec at 98°C and 8 sec at different annealing temperatures (Table 1). Quantification of qPCR products was performed using the CFX Manager Software 1.6 (Bio-Rad Laboratories GmbH). Serial dilutions of plasmid DNA were used for calibration. Glutaminase (GLS; for domestic cat, JQ424891), TATA box binding protein (TBP; for domestic cat, JQ424890; for lynx, JX993351), β-actin (BACT; for domestic cat, AB051104; for lynx, KM458620), glyceraldehyde 3-phosphate dehydrogenase (GAPDH; for lynx, KM458621) and ribosomal protein S7 (RPS7; for lynx, JX993349) were validated as optimal reference genes in feline CL with the qbasePLUS software (Biogazelle, Zwijnaarde, Belgium; [60 (link)]) and were used for normalization. A multiple normalization factor was calculated for individual CL referring to Vandesompele et al. [61 (link)].