Gotaq pcr kit
The GoTaq PCR kit is a reagent set designed for performing the Polymerase Chain Reaction (PCR) technique. It contains all the necessary components, including the GoTaq DNA polymerase enzyme, buffers, and nucleotides, to amplify specific DNA sequences.
Lab products found in correlation
14 protocols using gotaq pcr kit
Genome Sequencing via Overlapping RT-PCR
Daphnia ND5 Gene Amplification and Sequencing
Primer sequences used were as follows:
Primer: ND5 Forward: 5’-GAGGTGGTCCGCATTCTTTA-3’.
Primer :ND5 Reverse: 5’-AAAGTCAAGTAGCGCGGGTA-3.
Reverse Transcription and PCR for Daphnia Sir2
5′CATATGACCATGGCCGACGAACAAGGCGAG3′
Reverse:
5′ATGTTCTGCGTGTAGTTGCG3′
5′CGACCGTTCTTTAAATTCGC3′
Reverse:
5′TCAATCCATCGCTTTCCTTTTTAC3′
5′TTATCACCTCCTCAACTTC3′
Reverse:
5′CTTCTTCCTTCACTTCTCC3′
Mouse TCR Library Preparation
RVFV Genome Segment Amplification and Sequencing
List of primers used
Nom | Segment | Position | Sequence | Tm |
---|---|---|---|---|
NSng | S | 31–48 | TATCATGGATTACTTTCC | 48 |
NSca | S | 841–824 | CCTTAACCTCTAATCAAC | 50 |
M1F | M | 3–22 | ACAAAGACCGGTGCAACTTC | 53.9 |
M1R | M | 1120–1140 | CCAYGCAAAGGGTATGCAAT | 53.2 |
M2F | M | 1035–1054 | TGAGGACTCTGAATTRCACCT | 48.7 |
M2R | M | 2395–2415 | TCCAGAGAGTTGAGCCTTGC | 53.3 |
MRV1a | M | 3050–3068 | CAAATGACTACCAGTCAGC | 44.6 |
MRV2g | M | 2262–2292 | GGTGGAAGGACTCTGCGA | 52.5 |
M3F | M | 2979–2998 | CAGTCCTCAGTGAGCYCATA | 46.1 |
M3R | M | 3763–3782 | TCTCGGTTCTGGRGTGTGAA | 52.5 |
Sanger Sequencing of Candidate Genes
Genome Recovery from Flavivirus Samples
The PCR fragments were obtained using AMV reverse transcription kit (Promega, Madison, USA) for reverse transcription and Go-Taq PCR kit (Promega, Madison, USA) for amplification. The RT conditions were set according to the manufacturer’s instructions, and the PCR conditions were as follows: 5 minutes at 95°C, 40 cycles of 1 minute at 95°C, 1 minute at 53°C, 1 to 4 minutes (according the size of the PCR product) at 72°C, and 10 minutes at 72°C. The PCR products were purified from the agarose gel using the Gel extraction kit (Qiagen) and sequenced by Cogenics (Beckman Coulter Genomics, Essex, UK).
Profiling Phenoloxidase Expression in Daphnia
RNA Extraction and Quality Evaluation
Enteroid RNA Isolation and Gene Expression
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!