The presence of MG was investigated using qPCR targeting a 310 bp fragment of the proline-rich domain of the 16 s rRNA adhesin-encoding gene [23] (link). The forward primer 16 s rRNA-F (5' AGCTAATCTGTAAAGTTGGTC') and the reverse primer 16 s rRNA-R (5' GCTTCCTTGCGGTTAGCAAC 3') were used to type the DNA samples [23] (link). Amplification of the V3 region of the 16S rRNA gene was performed according to the methods of Muyzer et al. (1993) . Amplification of the with minor modifications using the universal template to 49 μl of a reaction mixture containing 10 mM Tris/HCl (pH 9.0), 1.5 mM MgCl 2 , 50 mM KCl, 0.1% Triton X-100, 0.2 mM of each deoxynucleotide triphosphate and 0.5 U of Taqgold (Applied Biosystems). The cycling procedure involved initial denaturation at 94 0 C for 5 min; 35 cycles of 94 0 C for 5 min, 50 0 C for 30 s, and 68 0 C for 1 min; and final elongation at 68 °C for 10 min. The samples were kept at 4 0 C until analysis. The integrity of the qPCR amplicons was visualized on a 1% agarose gel (CSL-AG500, Cleaver Scientific Ltd.) stained with EZ-vision® Bluelight DNA Dye.
Csl ag500
Manufactured by Cleaver Scientific
Sourced in United Kingdom
The CSL-AG500 is a laboratory centrifuge capable of processing samples up to 500 milliliters. It features a digital display, programmable controls, and a safety lid lock. The centrifuge can achieve a maximum speed of 4,500 revolutions per minute.
Automatically generated - may contain errors
Lab products found in correlation
Gel trans illuminator, by Bio-Rad (2 mentions)
Taqgold, by Thermo Fisher Scientific (1 mentions)
Pcr purification kit, by Qiagen (1 mentions)
Abi 3500xl genetic analyzer, by Thermo Fisher Scientific (1 mentions)
Zr 96 dna sequencing clean up kit, by Zymo Research (1 mentions)
Onetaq 2 master mix, by New England Biolabs (1 mentions)
Genomic dna purification kit k0722, by Thermo Fisher Scientific (1 mentions)
Dreamtaq, by Thermo Fisher Scientific (1 mentions)
Genejet genomic dna purification kit, by Thermo Fisher Scientific (1 mentions)
7 protocols using csl ag500
1
Molecular Detection of Mycoplasma Genitalium
2
PCR Product Visualization and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR products were visualized in 1.4% agarose gel(CSL-AG500, Cleaver Scientific Ltd., Rugby, UK) stained with EZ-vision®Bluelight DNA Dye (Bio-Rad Laboratories, Irvine, CA, USA). A100bp DNA ladder was used asa standard marker. PCR products were then purified using Qiagen PCR Purification Kit (Qiagen, Hilden, Germany) according to manufacturer’s protocol. Fragments were sequenced at Inqaba South Africa using the same forward and reverse primers as used to generate the PCR products. The labeled products were then cleaned with the ZR-96 DNA Sequencing Clean-up Kit (Zymoresearch, Irvine, CA, USA) (http://www.zymoresearch (accessed on 18 November 2019)). The cleaned products were injected on the Applied Biosystems ABI 3500XL Genetic Analyzer with a 50cm array using POP7 (Applied Biosystem, Foster city, CA, USA) (https://www.thermofisher.com (accessed on 18 November 2019)). Sequence chromatogram analysis was performed using Finch TV analysis software (Applied Biosystem, Foster city, CA, USA) (https://www.softpedia.com/get/Science-CAD/FinchTV.shtml (accessed on 18 November 2019)).
3
Standard mPCR Protocol for Amplicon Visualization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Standard mPCR was conducted using NEB OneTaq 2× MasterMix with Standard Buffer (10 μL). The reaction mixture contained gDNA (10–30 ng μL−1) (1 μL), forward primer (10 μM) (1 μL), reverse primer (10 μM) (1 μL), and nuclease-free water (7 μL). The reaction mixture was then mixed thoroughly by pipetting the mixture a few times, and subsequently, 20 μL of the final reaction mixture was dispensed into the PCR tubes. The PCR tubes were then placed in a thermal cycler for 35 cycles as follows: for the initial activation step, the tubes were subjected to 94°C for 5 min, denaturing occurred for 30 s at 94°C, annealing occurred for 30 s at 50°C, and extension occurred for 60 s at 68°C. The final extension was at 68°C for 10 min and the holding was at 4°C. After that, PCR amplicons were visualized on 1% of agarose gel (CSL-AG500, Cleaver Scientific [Ltd]) and stained with EZ-vision® Bluelight DNA dye under UV light.
4
Antibiotic Resistance Gene Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In addition to phenotypic-resistance profiling, various ARGs (Table 5 ) were identified with the help of PCR using specific primers. The DNA was extracted using a Genomic DNA purification kit K0722 (Thermo-Scientific™, Waltham, MA, USA). A total of 25 μL reaction mixture for PCR was comprised of 5 μL DNA template, 10 μL Green DreamTaq mix (Thermo Fisher Scientific, Waltham, MA, USA), and F&R primers (100 pM) 1 μL each. A total of 8 μL SuperQ nuclease-free water was added to get the desired volume (25 μL). Lastly, 1.5% agarose (CSL-AG500; CLEAVER SCIENTIFIC®, Rugby, UK) gel electrophoresis was carried out to examine the PCR products.
5
APEC Virulence Factors Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Overall, different VAGs were detected through PCR, using specific primers in addition to the marker VAGs for APEC, e.g., ompT, hylF, iutA, ironN, and iss, etc. The presence of a minimum of three APEC-specific VAGs was considered for confirmation of the isolate. For this purpose, isolates were subjected to DNA extraction using the GeneJET Genomic DNA purification kit K0722 (Thermo-Scientific™), according to the given protocol.
Subsequently, PCR (T3000, Thermo-cycler:48 Biomerta™, Göttingen, Germany) was carried out with specific conditions for VAGs, along with their respective annealing temperature given inTable 5 . The reaction setup was comprised of initial denaturation of template DNA at 94 °C for 5 min, followed by 30 reaction cycles of DNA denaturation at 94 °C for 1 min, specific primer annealing for 85 s, and extension at 72 °C for 60 s. Finally, a 10 min extension was carried out at 72 °C.
The PCR reaction mixture (25 μL) contained: template DNA 5 μL, F&R primers (100 pM) 1 μL each, DreamTaq (Thermo-Scientific™, Waltham, MA, USA) 8 μL, and SuperQ water (Ambion-AM9932, Thermo-Scientific™, Waltham, MA, USA) 10 μL. For the examination of PCR amplicons, agarose (CSL-AG500; CLEAVER SCIENTIFIC®, Rugby, UK) gel electrophoresis was carried out and visualized under a gel trans-illuminator (BioRad, Hercules, CA, USA).
Subsequently, PCR (T3000, Thermo-cycler:48 Biomerta™, Göttingen, Germany) was carried out with specific conditions for VAGs, along with their respective annealing temperature given in
The PCR reaction mixture (25 μL) contained: template DNA 5 μL, F&R primers (100 pM) 1 μL each, DreamTaq (Thermo-Scientific™, Waltham, MA, USA) 8 μL, and SuperQ water (Ambion-AM9932, Thermo-Scientific™, Waltham, MA, USA) 10 μL. For the examination of PCR amplicons, agarose (CSL-AG500; CLEAVER SCIENTIFIC®, Rugby, UK) gel electrophoresis was carried out and visualized under a gel trans-illuminator (BioRad, Hercules, CA, USA).
6
Serotyping and Diversity Analysis of CR-APEC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Only CR-APEC (n = 13) were subjected to O-antigen-based serogrouping. Isolates were examined for three different and prevalent serogroups, as described previously [21 (link)], which include O1, O2, and O78. Extracted DNA was subjected to PCR using specific primers (Table 5 ), as described previously [21 (link)], for each of the serogroups, with thermocycler conditions as follows: a total of 25 cycles of denaturation at 94 °C for 40 s, annealing at 59 °C for 35 s, and extension at 72 °C for 60 sec. Subsequently, agarose (CSL-AG500; CLEAVER SCIENTIFIC®, Rugby, UK) gel electrophoresis was performed and imagined under a gel transilluminator (BioRad, Hercules, CA, USA). Additionally, gene diversity was observed with respect to the O antigen and VAGs present in CR-APEC.
7
PCR Product Size Analysis & Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 1.5 percent agarose gel used to separate the PCR products was stained with ethidium bromide. The size of the DNA fragment was measured using Ingenius' Syngene Gel Documentation System and compared to the Hyper Ladder-2K marker on a 1 percent agarose gel (CSL-AG500, Cleaver Scientific Ltd.) (IG31459). A positive result was the existence of a product with the anticipated size. The PCR product was then send for sequencing. DNA sequencing was performed according to manufacturer's instructions using the ABI Prism Big DyeTM 3730/3730XL Terminator Cycle Sequencing Ready Reaction Kit.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!