Geneart site directed mutagenesis

For miR target validation, the putative (seed) binding site of miR-101-3p in the 3′UTR of COX-2 predicted by TargetScan 7.2 (position 1737-1744 of PTGS2 3’ UTR) and the mutant (MUT) 3′UTR of COX-2 with one nucleotide substitution were cloned into pmirGLO Dual-Luciferase miRNA Target Expression Vector (pmirGLO-empty, Promega, USA) downstream of the firefly luciferase gene (XbaI and Nhe sites) to obtain Luc Reporter Construct (pmirGLO-seed and pmirGLO-mut). The primers used for cloning 172 bp of 3′-UTR-COX2 in pmirGLO vector: Forward 5′AAGCTAGCTGATATCTAAGTAGTTCTCAGC 3′; Reverse 5′AATCTAGACAATGATTGTAGGCTTAAACAC 3′ (seed). The mutant primers used to introduce a mutation by site directed mutgenesis (GeneArt Site-Directed Mutagenesis, invitrogen, USA) are the following: Forward 5′ ATTTAATGGTATTGTATATTACTTA 3′; Reverse 5′ TAAGTAATATACAATACCATTAAAT 3′ (mut). MDA-MB-231 cells were plated at a density of 10⁵ cells/well in a 96-well plate and co-transfected with pmirGLO-empty (100 ng), pmirGLO -seed (100 ng), miR-101 mimic (5 nM) and negative scrambled control depending on treatments and following Lipofectamine 3000 reagent protocol. Cells were harvested 24 h after transfection and cell lysates were used for Dual-Luciferase^® Reporter Assay System analysis according to the manufacturer’s instructions (Promega, USA).