EL—forward primer (5′-3′) ACCAGAGTGGTGGGACGTAG; reverse primer (5′-3′) GGACAGCCTCCTGTTGATGT
Cyclophilin A—forward primer (5′-3′) TGTCTCTTTTCGCCGCTTGCTG; reverse primer (5′-3′) CACCACCCTGGCACATGAATCC
RNase-free DNase I treatment is a laboratory product that degrades DNA in RNA samples. It helps remove contaminating DNA from RNA preparations, ensuring the integrity and purity of RNA for downstream applications.
EL—forward primer (5′-3′) ACCAGAGTGGTGGGACGTAG; reverse primer (5′-3′) GGACAGCCTCCTGTTGATGT
Cyclophilin A—forward primer (5′-3′) TGTCTCTTTTCGCCGCTTGCTG; reverse primer (5′-3′) CACCACCCTGGCACATGAATCC
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!