Isolation of total RNA from tissues and cells was performed using TRIzol solution (Beyotime Biotechnology, Shanghai, China). The purity of the extracted RNA was tested with the BioPhotometer plus (Eppendorf, Germany). Synthesis of cDNA was carried out using PrimeScriptTM strand cDNA Synthesis Mix (TaKaRa Biomedical Technology Co., Ltd, Beijing, China). SYBR Green qPCR SuperMix (Invitrogen, CA, USA) was used to measure the relative expression levels of XIST, miR-758, and Rab16. The reaction was performed on the ABI PRISM 7500 Sequence Detection System (Applied Biosystems, CA, USA), and the reaction conditions were: 95 °C for 5 minutes, 40 cycles of 95 °C for 15 seconds, 60 °C for 32 seconds, and 72 °C for 20 seconds. GAPDH served as an endogenous control for XIST and Rab16. U6 small nuclear RNA (snRNA) served as an endogenous control for miR-758. Data were analyzed using the 2−ΔΔCt method.
Trizol solution
Manufactured by Beyotime
Sourced in China
TRIzol is a ready-to-use reagent for the isolation of total RNA from a variety of biological samples. It is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components.
Automatically generated - may contain errors
Lab products found in correlation
Primescript rt kit, by Takara Bio (2 mentions)
Abi prism 7500 sequence detection system, by Thermo Fisher Scientific (1 mentions)
Sybr green qpcr supermix, by Thermo Fisher Scientific (1 mentions)
Biophotometer plus, by Eppendorf (1 mentions)
Talent fluorescence quantitative detection kit sybr green, by Tiangen Biotech (1 mentions)
Sybr green master mix, by Bio-Rad (1 mentions)
First strand synthesis kit, by Vazyme (1 mentions)
Sybr green kit, by ABclonal (1 mentions)
5 protocols using trizol solution
1
Quantification of XIST, miR-758, and Rab16 Expression
2
Quantitative RT-PCR for mRNA and microRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The relative expression of mRNA and microRNAs was detected by the quantitative RT‐PCR (qRT‐PCR) method using total RNA samples isolated from cells, exosomes or tissues with the TRIzol solution (#R0016; Beyotime, Beijing, China), following the manufacturer's instructions. Subsequently, the cDNA library was established from 2 μg RNA samples using the miScript II RT Kit (Cat. No. 218160; Qiagen) according to the manufacturer's instructions. The Talent Fluorescence Quantitative Detection Kit (SYBR Green) (#FP209; Tiangen Biotech, Beijing, China) was instructed by the manufacturer. The GAPDH was used as the internal standard, and relative expressional levels were finally calculated through the standard 2‐△△Ct method based on at least three biological replicates.
3
Anti-proliferative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After fine-tuning based on Yang’s method [22 (link)], the total RNA was extracted by crushing the nematodes and then adding 1 mL of TRIzol solution (Beyotime, Shanghai, China). As described in the Prime ScriptTM RT kit (Takara, Beijing, China, the cDNA was obtained by reverse transcription reflection in a PCR instrument (Eppendorf, Shanghai, China). Following this, real-time PCR was completed using the iQ TM SYBR R Green Supermix kit and anti-proliferative factor expression was detected by the BIO-RADCFX48TM real-time system. Lastly, the relative expression of the anti-proliferative genes was calculated based on the 2ΔΔCt. Real-time PCR primer sequences can be found in Supplementary Table S5 .
4
Quantification of miRNA and NPAT Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from tissues, plasma or exosomes with Trizol solution (Beyotime). Reverse transcription was performed with the PrimeScript RT Kit (Takara) following the protocol. Quantification of miRNA and nuclear protein ataxia‐telangiectasia (NPAT) was determined using the SYBR Green Master Mix (BioRad). U6 RNA (U6) or glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) was detected as the normalization control for miRNA or mRNA levels, respectively. The primer sequences were as follows: miR‐20a‐5p forward, 5′‐GCCCGCTAAAGTGCTTATAGTG‐3′, reverse, 5′‐CCAGTGCAGGGTCCGAGGT‐3′; NPAT forward, 5′‐GCATGCAAAGTTCCCCAAGG‐3′, and reverse, 5′‐TGGCCACTTGGTCGAGTAAC‐3′.
5
Quantitative Analysis of ccRCC Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from ccRCC tissues and cell lines with Trizol solution (#R0016, Beyotime, Shanghai, China). The cDNA was synthesized with a First Strand Synthesis Kit (#R212‐02, Vazyme, Nanjing, Jiangsu, China), and qPCR was performed with a Sybr Green Kit (#RK21203, ABclonal, Wuhan, Hubei, China) on qTOWER Thermocycler (Analytik Jena, Jena, Germany) following the conditions: 95°C for 3 min, 45 cycles of 95°C for 5 s and 60°C for 30 s. Relative mRNA levels were calculated using the 2–ΔΔCt method. Primers were synthesized by Tsingke (Beijing, China), and their sequences are listed in Supplementary Table S1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!